View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2518_high_10 (Length: 231)

Name: NF2518_high_10
Description: NF2518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2518_high_10
NF2518_high_10
[»] chr5 (2 HSPs)
chr5 (1-87)||(11399461-11399549)
chr5 (172-223)||(11399634-11399685)


Alignment Details
Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 11399461 - 11399549
Alignment:
1 aacaacatggagaagtgactaactct--ctctctttttcagctgctaattctgtatttgttactagctcagactcagacatcatcttac 87  Q
    ||||||||||||||||||||||||||  ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
11399461 aacaacatggagaagtgactaactctctctctctttttcggctgctaattatgtatttgttactagctcagactcagacatcatcttac 11399549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 172 - 223
Target Start/End: Original strand, 11399634 - 11399685
Alignment:
172 atgaaataagggtttatgtgttctgtttgttggtgtttcgttctcctttgct 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
11399634 atgaaataagggtttatgtgttctgtttgttggtgtttcgttctcctttgct 11399685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University