View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2518_high_10 (Length: 231)
Name: NF2518_high_10
Description: NF2518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2518_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 11399461 - 11399549
Alignment:
| Q |
1 |
aacaacatggagaagtgactaactct--ctctctttttcagctgctaattctgtatttgttactagctcagactcagacatcatcttac |
87 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11399461 |
aacaacatggagaagtgactaactctctctctctttttcggctgctaattatgtatttgttactagctcagactcagacatcatcttac |
11399549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 172 - 223
Target Start/End: Original strand, 11399634 - 11399685
Alignment:
| Q |
172 |
atgaaataagggtttatgtgttctgtttgttggtgtttcgttctcctttgct |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11399634 |
atgaaataagggtttatgtgttctgtttgttggtgtttcgttctcctttgct |
11399685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University