View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2518_low_10 (Length: 250)
Name: NF2518_low_10
Description: NF2518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2518_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 10 - 178
Target Start/End: Complemental strand, 12164135 - 12163967
Alignment:
| Q |
10 |
aagaaaatgattttgactgttagtacttagtagtatatatggtatcggtagtttgtgtttagataataaaatccagcaaaacgaggttggcatttaatca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12164135 |
aagaaaatgattttgactgttagtacttagtagtatatatggtatcggtagtttgtgtttagataataaaatccagcaaaacgaggttggcatttaatca |
12164036 |
T |
|
| Q |
110 |
tttagcatgtgcatgctcaactatttgtgcatgtttctttataattgtagtagaatccatgatcagtgt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12164035 |
tttagcatgtgcatgctcaactatttgtgcatgtttctttataattgtagtagaatccatgatcagtgt |
12163967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University