View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_high_129 (Length: 262)
Name: NF2519_high_129
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_high_129 |
 |  |
|
| [»] scaffold0063 (1 HSPs) |
 |  |  |
|
| [»] scaffold0238 (1 HSPs) |
 |  |  |
|
| [»] scaffold0126 (1 HSPs) |
 |  |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0211 (1 HSPs) |
 |  |  |
|
| [»] scaffold0199 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0194 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 54; Significance: 4e-22; HSPs: 17)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 16 - 81
Target Start/End: Complemental strand, 10828760 - 10828695
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggttatgttagtttctt |
81 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
10828760 |
ctcctacttaaggtctcaggttcgattatctatgatgccaatttgagggggttaggttagtttctt |
10828695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 15048088 - 15048035
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15048088 |
ctcctcctcaaggtctcaggttcgattatctctggtgccaatttgagggggtta |
15048035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 194 - 239
Target Start/End: Complemental strand, 10828658 - 10828613
Alignment:
| Q |
194 |
aaggtattaatttataaaattgtgttttaagcatgacgattggaga |
239 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
10828658 |
aaggtattaatttaaaaaactgtgttttaagcatgacgattggaga |
10828613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 30311355 - 30311408
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| ||||||||||||||||||||| ||| || ||||||||||||||||||| |
|
|
| T |
30311355 |
ctcctcctcaaggtctcaggttcgattctctttggtgccaatttgagggggtta |
30311408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 46518677 - 46518730
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| |||||||| ||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
46518677 |
ctcctcctcaaggtttcaggtttgattctctctgatgccaatttgagggggtta |
46518730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 53412994 - 53413047
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| ||||||||||||||||| ||| |||||| ||||||||||||||||||| |
|
|
| T |
53412994 |
ctcctcctcaaggtctcaggttcaattctctctggtgccaatttgagggggtta |
53413047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 23 - 69
Target Start/End: Complemental strand, 28703424 - 28703378
Alignment:
| Q |
23 |
tcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||| ||||| |
|
|
| T |
28703424 |
tcaaggtctcaggttcgattctctctggtgccaatttgaggaggtta |
28703378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 24 - 69
Target Start/End: Complemental strand, 10969936 - 10969891
Alignment:
| Q |
24 |
caaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||| ||||||||| |
|
|
| T |
10969936 |
caaggtctcaggttcgattctctctggtgccaatttaagggggtta |
10969891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 65
Target Start/End: Complemental strand, 37788492 - 37788443
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggg |
65 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
37788492 |
ctcctcctcaaggtctcaggttcgattctctctagtgccaatttgagggg |
37788443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 16 - 63
Target Start/End: Complemental strand, 34062575 - 34062528
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagg |
63 |
Q |
| |
|
||||| ||||||||||||||||| ||| |||||| ||||||||||||| |
|
|
| T |
34062575 |
ctcctcctcaaggtctcaggttcaattctctctggtgccaatttgagg |
34062528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 15 - 62
Target Start/End: Complemental strand, 34622569 - 34622522
Alignment:
| Q |
15 |
actcctactcaaggtctcaggttcgattatctctgatgccaatttgag |
62 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||| || ||||||||| |
|
|
| T |
34622569 |
actcctcctcaaggtctcaggttcgattttctctggtgtcaatttgag |
34622522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 62
Target Start/End: Complemental strand, 8796120 - 8796074
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgag |
62 |
Q |
| |
|
||||| |||||||||||| |||||||| |||||||||| |||||||| |
|
|
| T |
8796120 |
ctcctcctcaaggtctcaagttcgattctctctgatgctaatttgag |
8796074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 57
Target Start/End: Original strand, 39253753 - 39253787
Alignment:
| Q |
23 |
tcaaggtctcaggttcgattatctctgatgccaat |
57 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
39253753 |
tcaaggtctcaggttcgattctctctgatgccaat |
39253787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 81
Target Start/End: Original strand, 19154680 - 19154745
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggttatgttagtttctt |
81 |
Q |
| |
|
||||| || |||||||||||||||||| ||| ||||| ||||||| | |||||| |||||||||| |
|
|
| T |
19154680 |
ctcctcctaaaggtctcaggttcgattctctttgatgtcaatttgggtgggttagtttagtttctt |
19154745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 61
Target Start/End: Complemental strand, 27093388 - 27093343
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttga |
61 |
Q |
| |
|
||||| |||||||||||||||| |||| |||||| ||||||||||| |
|
|
| T |
27093388 |
ctcctcctcaaggtctcaggtttgattctctctggtgccaatttga |
27093343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 27259210 - 27259263
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| ||| |||| ||||||| |||| ||||||||| |||||||||||||||| |
|
|
| T |
27259210 |
ctcctcctcgaggtttcaggtttgattctctctgatgtcaatttgagggggtta |
27259263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 60
Target Start/End: Original strand, 8170721 - 8170765
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttg |
60 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| || ||||||| |
|
|
| T |
8170721 |
ctcctactcaaggtctcaggttcgatttcctctggtgtcaatttg |
8170765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 16)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 13803544 - 13803597
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13803544 |
ctcctcctcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
13803597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 143 - 196
Target Start/End: Original strand, 42358110 - 42358163
Alignment:
| Q |
143 |
aaaaatgaaatttgccctcacgcaggatcgaactacggacctccagtttacaag |
196 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42358110 |
aaaaaagaaatttgccctcacgcaggatcgaactacggacctccagtttacaag |
42358163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 4226107 - 4226156
Alignment:
| Q |
12 |
tatactcctactcaaggtctcaggttcgattatctctgatgccaatttga |
61 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
4226107 |
tatactcctcctcaaggtttcaggttcgattatctctgatgttaatttga |
4226156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 30410576 - 30410523
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| ||||||| |||| |||||||| |||||| ||||||||||||||||||| |
|
|
| T |
30410576 |
ctcctcctcaaggactcatgttcgattttctctggtgccaatttgagggggtta |
30410523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 34041615 - 34041562
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| |||||||||||||||| |||| ||||| ||||||||||||||||||| |
|
|
| T |
34041615 |
ctcctcctcaaggtctcaggtttgattccctctggtgccaatttgagggggtta |
34041562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 40416417 - 40416364
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| || |||||||||||||||||| |||||| ||||||||||| ||||||| |
|
|
| T |
40416417 |
ctcctccttaaggtctcaggttcgattctctctggtgccaatttgaaggggtta |
40416364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 45026792 - 45026845
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| |||||||||||| ||| |||| |||||| ||||||||||||||||||| |
|
|
| T |
45026792 |
ctcctcctcaaggtctcatgtttgattctctctggtgccaatttgagggggtta |
45026845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 80
Target Start/End: Original strand, 19244166 - 19244222
Alignment:
| Q |
24 |
caaggtctcaggttcgattatctctgatgccaatttgagggggttatgttagtttct |
80 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||| ||| || ||||||||| |
|
|
| T |
19244166 |
caaggtctcaggttcgattctctctggtgccaatttgagtgggctaatttagtttct |
19244222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 69
Target Start/End: Original strand, 42922473 - 42922517
Alignment:
| Q |
25 |
aaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||| ||||||| |
|
|
| T |
42922473 |
aaggtctcaggttcgattctctctggtgccaatttgatggggtta |
42922517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 22 - 69
Target Start/End: Complemental strand, 2750647 - 2750600
Alignment:
| Q |
22 |
ctcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
|||||||||||| |||||||| ||||| ||||||||||||||||||| |
|
|
| T |
2750647 |
ctcaaggtctcatgttcgattctctctagtgccaatttgagggggtta |
2750600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 22 - 69
Target Start/End: Complemental strand, 4060235 - 4060188
Alignment:
| Q |
22 |
ctcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
|||||| |||||||||||||| |||||| || |||||||||||||||| |
|
|
| T |
4060235 |
ctcaagatctcaggttcgattctctctggtgtcaatttgagggggtta |
4060188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 66
Target Start/End: Original strand, 14500326 - 14500376
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgaggggg |
66 |
Q |
| |
|
||||| ||| ||||||||| ||||||| |||||| |||||||||||||||| |
|
|
| T |
14500326 |
ctcctcctctaggtctcagattcgattctctctggtgccaatttgaggggg |
14500376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 21304021 - 21303968
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| || ||||| |||||||||||| |||||| || |||||||||||||||| |
|
|
| T |
21304021 |
ctcctcctgaaggtttcaggttcgattctctctggtgtcaatttgagggggtta |
21303968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 26 - 58
Target Start/End: Complemental strand, 9318092 - 9318060
Alignment:
| Q |
26 |
aggtctcaggttcgattatctctgatgccaatt |
58 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
9318092 |
aggtctcaggttcgattctctctgatgccaatt |
9318060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 23 - 59
Target Start/End: Original strand, 9776360 - 9776396
Alignment:
| Q |
23 |
tcaaggtctcaggttcgattatctctgatgccaattt |
59 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
9776360 |
tcaagatctcaggttcgattatctctgatgctaattt |
9776396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 23 - 59
Target Start/End: Complemental strand, 33605827 - 33605791
Alignment:
| Q |
23 |
tcaaggtctcaggttcgattatctctgatgccaattt |
59 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33605827 |
tcaaggtctcatattcgattatctctgatgccaattt |
33605791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 17)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 16 - 81
Target Start/End: Complemental strand, 37109378 - 37109313
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggttatgttagtttctt |
81 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
37109378 |
ctcctcctcaaggtctcaggttcgattctctctggtgccaatttgagggggttagtttagtttctt |
37109313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 153 - 196
Target Start/End: Complemental strand, 25371713 - 25371670
Alignment:
| Q |
153 |
tttgccctcacgcaggatcgaactacggacctccagtttacaag |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25371713 |
tttgccctcacgcaggatcgaactacggaccttcagtttacaag |
25371670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 2185059 - 2185006
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| ||||| ||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
2185059 |
ctccttctcaaagtctcaggttcgattctctccgatgccaatttgagggggtta |
2185006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 4249226 - 4249279
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| |||||||||||||||| |||| |||||| ||||||||||||||||||| |
|
|
| T |
4249226 |
ctcctcctcaaggtctcaggtttgattctctctggtgccaatttgagggggtta |
4249279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 16581742 - 16581795
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||| |||||||||||| |||||| |
|
|
| T |
16581742 |
ctcctcctcaaggtctcaggttctattatctctggtgccaatttgagagggtta |
16581795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 196
Target Start/End: Complemental strand, 33870985 - 33870944
Alignment:
| Q |
155 |
tgccctcacgcaggatcgaactacggacctccagtttacaag |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33870985 |
tgccctcacgcaggatcgaactacggaccttcagtttacaag |
33870944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 38869817 - 38869870
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
38869817 |
ctcctcctcaaggtctcaggttcgattccctctggtgccaatttgagggggtta |
38869870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 25 - 69
Target Start/End: Complemental strand, 27372675 - 27372631
Alignment:
| Q |
25 |
aaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27372675 |
aaggtcttaggttcgattatctctgatgccaatttgaaggggtta |
27372631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 22 - 69
Target Start/End: Original strand, 15180793 - 15180840
Alignment:
| Q |
22 |
ctcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
|||||||||| |||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
15180793 |
ctcaaggtcttaggttcgattctctctggtgccaatttgagggggtta |
15180840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 16 - 66
Target Start/End: Original strand, 23378005 - 23378055
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgaggggg |
66 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
23378005 |
ctcctcctcaaggtctcaggttcgattctctctagtgccaatttgaggggg |
23378055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 7292825 - 7292772
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| ||||| ||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
7292825 |
ctcctcctcaaagtctcaggttcgattctctctagtgccaatttgagggggtta |
7292772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 10048029 - 10048082
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| |||| |||||||||||||||| |||||||||| ||||||| ||||||| |
|
|
| T |
10048029 |
ctccttctcatggtctcaggttcgattctctctgatgctaatttgaaggggtta |
10048082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 69
Target Start/End: Complemental strand, 6666452 - 6666400
Alignment:
| Q |
17 |
tcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
|||| |||||| |||||||||||||| |||||| |||| |||||||||||||| |
|
|
| T |
6666452 |
tcctcctcaagatctcaggttcgattctctctggtgcccatttgagggggtta |
6666400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 69
Target Start/End: Original strand, 20770961 - 20771013
Alignment:
| Q |
17 |
tcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
|||| |||||||||||| |||||||| |||| | ||||||||||||||||||| |
|
|
| T |
20770961 |
tccttctcaaggtctcaagttcgattctctcaggtgccaatttgagggggtta |
20771013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 65
Target Start/End: Original strand, 7539639 - 7539688
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggg |
65 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||| || |||||||||||| |
|
|
| T |
7539639 |
ctccttctcaaggtctcaggttcgattctctcttctgtcaatttgagggg |
7539688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 33632163 - 33632110
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| ||||||||| |||| |||||| |||||| || |||||||||||||||| |
|
|
| T |
33632163 |
ctcctcctcaaggtcccaggatcgattctctctggtgtcaatttgagggggtta |
33632110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 60
Target Start/End: Original strand, 51622534 - 51622578
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttg |
60 |
Q |
| |
|
||||| ||||||||||||||||||| | |||||| |||||||||| |
|
|
| T |
51622534 |
ctcctcctcaaggtctcaggttcgactctctctggtgccaatttg |
51622578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 16)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 16 - 78
Target Start/End: Original strand, 14285210 - 14285271
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggttatgttagttt |
78 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||| ||||||||||||||||||| |||||||| |
|
|
| T |
14285210 |
ctcctcctcaaggtctcaggttcgattctctctggtgccaatttgagggggtta-gttagttt |
14285271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 155 - 196
Target Start/End: Complemental strand, 2639574 - 2639533
Alignment:
| Q |
155 |
tgccctcacgcaggatcgaactacggacctccagtttacaag |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2639574 |
tgccctcacgcaggatcgaactacggacctccagtttacaag |
2639533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 18596028 - 18595975
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| |||||||||| |||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
18596028 |
ctcctcctcaaggtcttaggttcgattttctctggtgccaatttgagggggtta |
18595975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 17 - 81
Target Start/End: Complemental strand, 2269250 - 2269186
Alignment:
| Q |
17 |
tcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggttatgttagtttctt |
81 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||| ||||||||||||||||| |||| ||||| |
|
|
| T |
2269250 |
tcctcctcaaggtctcaaattcgattatctctgataacaatttgagggggttattttagcttctt |
2269186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 16 - 68
Target Start/End: Original strand, 34984855 - 34984907
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtt |
68 |
Q |
| |
|
||||| |||||||||| |||||||||| |||||| |||||||||||||||||| |
|
|
| T |
34984855 |
ctcctcctcaaggtcttaggttcgattctctctggtgccaatttgagggggtt |
34984907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 15 - 65
Target Start/End: Complemental strand, 7918497 - 7918447
Alignment:
| Q |
15 |
actcctactcaaggtctcaggttcgattatctctgatgccaatttgagggg |
65 |
Q |
| |
|
|||||| |||||||||| |||||||||| |||||| ||||||||||||||| |
|
|
| T |
7918497 |
actcctcctcaaggtcttaggttcgattctctctggtgccaatttgagggg |
7918447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 23 - 69
Target Start/End: Complemental strand, 26078071 - 26078025
Alignment:
| Q |
23 |
tcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
26078071 |
tcaaggtctcaggttcgattctctctagtgccaatttgagggggtta |
26078025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 65
Target Start/End: Original strand, 25627106 - 25627155
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggg |
65 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||| || |||||||||||| |
|
|
| T |
25627106 |
ctcctcctcaaggtctcaggttcgattctctctggtgtcaatttgagggg |
25627155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 25979219 - 25979272
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||| ||| |||||||| ||||||| |
|
|
| T |
25979219 |
ctcctcctcaaggtctcaggttcgattctctcttatgtcaatttgatggggtta |
25979272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 37258393 - 37258340
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| |||||||| |||||||||||| |||||| || |||||||||||||||| |
|
|
| T |
37258393 |
ctcctcctcaaggtttcaggttcgattctctctggtgtcaatttgagggggtta |
37258340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 16773856 - 16773899
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaattt |
59 |
Q |
| |
|
||||| ||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
16773856 |
ctcctcctcgaggtctcaggttcgattctctctgatgccaattt |
16773899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 150 - 196
Target Start/End: Original strand, 9749207 - 9749253
Alignment:
| Q |
150 |
aaatttgccctcacgcaggatcgaactacggacctccagtttacaag |
196 |
Q |
| |
|
|||| ||||| || ||||||||||||||| ||||||||||||||||| |
|
|
| T |
9749207 |
aaatctgcccccatgcaggatcgaactacagacctccagtttacaag |
9749253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 18974009 - 18974062
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| |||||||| |||||||||||| || ||| |||||||||||| |||||| |
|
|
| T |
18974009 |
ctcctcctcaaggtgtcaggttcgattctccctggtgccaatttgagtgggtta |
18974062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 30735094 - 30735041
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| ||||| ||||| ||||||||| |||||||| |||||||||||||||| |
|
|
| T |
30735094 |
ctcctcctcaaaatctcaagttcgattacctctgatgtcaatttgagggggtta |
30735041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 22 - 58
Target Start/End: Complemental strand, 14656665 - 14656629
Alignment:
| Q |
22 |
ctcaaggtctcaggttcgattatctctgatgccaatt |
58 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
14656665 |
ctcaaggtctcaggttcgattgtttctgatgccaatt |
14656629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 60
Target Start/End: Original strand, 43442245 - 43442289
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttg |
60 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||| || ||||||| |
|
|
| T |
43442245 |
ctcctcctcaaggtctcaggttcgattctctctgttgtcaatttg |
43442289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 22)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 43215233 - 43215286
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
43215233 |
ctcctcctcaaggtctcaggttcgattctctcttatgccaatttgagggggtta |
43215286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 196
Target Start/End: Original strand, 22365594 - 22365635
Alignment:
| Q |
155 |
tgccctcacgcaggatcgaactacggacctccagtttacaag |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22365594 |
tgccctcacgcaggatcgaactacggaccttcagtttacaag |
22365635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 26459437 - 26459384
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||| ||||||||||| ||||||| |
|
|
| T |
26459437 |
ctcctcctcaaggtctcaggttcgattctctctggtgccaatttgaaggggtta |
26459384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 39631893 - 39631946
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
39631893 |
ctcctcctcaaggtctcaggttcgattctctcttgtgccaatttgagggggtta |
39631946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 14 - 62
Target Start/End: Complemental strand, 13106811 - 13106763
Alignment:
| Q |
14 |
tactcctactcaaggtctcaggttcgattatctctgatgccaatttgag |
62 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
13106811 |
tactcctcctcaaggtctcaggttcgattctctctgatgctaatttgag |
13106763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 22 - 69
Target Start/End: Original strand, 17113850 - 17113897
Alignment:
| Q |
22 |
ctcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||| |
|
|
| T |
17113850 |
ctcaaggtctcaagttcgattctctctgatgctaatttgagggggtta |
17113897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 12 - 62
Target Start/End: Complemental strand, 29538593 - 29538543
Alignment:
| Q |
12 |
tatactcctactcaaggtctcaggttcgattatctctgatgccaatttgag |
62 |
Q |
| |
|
||||||||| |||||||||||| |||||||| || |||||||||||||||| |
|
|
| T |
29538593 |
tatactccttctcaaggtctcaagttcgattctccctgatgccaatttgag |
29538543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 21570059 - 21570006
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| |||||||||||| |||||||| |||||| || |||||||||||||||| |
|
|
| T |
21570059 |
ctcctcctcaaggtctcaagttcgattttctctggtgtcaatttgagggggtta |
21570006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 155 - 196
Target Start/End: Original strand, 22361908 - 22361949
Alignment:
| Q |
155 |
tgccctcacgcaggatcgaactacggacctccagtttacaag |
196 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
22361908 |
tgccctcacgcaggatcgaactacagaccttcagtttacaag |
22361949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 12 - 69
Target Start/End: Original strand, 27255378 - 27255435
Alignment:
| Q |
12 |
tatactcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||||||| ||||| |||||||||| |||| ||||||||| ||| |||||||||||| |
|
|
| T |
27255378 |
tatactccttctcaaagtctcaggtttgattttctctgatgtcaaattgagggggtta |
27255435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 29785328 - 29785275
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| |||||||||||| |||||||| | |||| ||||||||||||||||||| |
|
|
| T |
29785328 |
ctcctcctcaaggtctcatgttcgattctttctggtgccaatttgagggggtta |
29785275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 33869472 - 33869419
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| ||||||||||| ||||||||| |||||| || |||||||||||||||| |
|
|
| T |
33869472 |
ctccttctcaaggtctctggttcgattctctctggtgtcaatttgagggggtta |
33869419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 16 - 67
Target Start/End: Complemental strand, 7744139 - 7744088
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggt |
67 |
Q |
| |
|
||||| |||||||||||||||| |||| |||||| ||| ||||||||||||| |
|
|
| T |
7744139 |
ctcctcctcaaggtctcaggtttgattctctctggtgcaaatttgagggggt |
7744088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 21558177 - 21558220
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaattt |
59 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
21558177 |
ctcctcctcaaggtctcaggttcgattctctctggtgccaattt |
21558220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 17 - 68
Target Start/End: Complemental strand, 25655254 - 25655203
Alignment:
| Q |
17 |
tcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtt |
68 |
Q |
| |
|
|||| |||||||| |||||||||||| |||||| ||||||||||| |||||| |
|
|
| T |
25655254 |
tcctcctcaaggtttcaggttcgattctctctggtgccaatttgaaggggtt |
25655203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 31835241 - 31835284
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaattt |
59 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
31835241 |
ctcctcctcaaggtctcaggttcgattatccctggtgccaattt |
31835284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 22 - 69
Target Start/End: Original strand, 33222425 - 33222472
Alignment:
| Q |
22 |
ctcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||||||||||||||||||| |||||| || ||||||||| |||||| |
|
|
| T |
33222425 |
ctcaaggtctcaggttcgattctctctggtgtcaatttgagagggtta |
33222472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 22 - 65
Target Start/End: Complemental strand, 37162371 - 37162328
Alignment:
| Q |
22 |
ctcaaggtctcaggttcgattatctctgatgccaatttgagggg |
65 |
Q |
| |
|
|||||||||||| |||||||| |||||| ||||||||||||||| |
|
|
| T |
37162371 |
ctcaaggtctcaagttcgattctctctggtgccaatttgagggg |
37162328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 62
Target Start/End: Original strand, 11700214 - 11700259
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgag |
62 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
11700214 |
ctcctcctcaaggtctcaggttcgattctctctg-tgccaatttgag |
11700259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 62
Target Start/End: Original strand, 22760912 - 22760958
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgag |
62 |
Q |
| |
|
||||| ||||||||||||||||||||| || | |||||||||||||| |
|
|
| T |
22760912 |
ctcctcctcaaggtctcaggttcgattctccccgatgccaatttgag |
22760958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 81
Target Start/End: Complemental strand, 9183218 - 9183153
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggttatgttagtttctt |
81 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||| || ||||||| | ||| || |||||||||| |
|
|
| T |
9183218 |
ctcctcctcaaagtctcaggttcgattatctctggtgtcaatttgggtgggctaatttagtttctt |
9183153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 22 - 59
Target Start/End: Original strand, 30579390 - 30579427
Alignment:
| Q |
22 |
ctcaaggtctcaggttcgattatctctgatgccaattt |
59 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
30579390 |
ctcaaggtctcaggttcgattttctctggtgccaattt |
30579427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 17)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 2799911 - 2799964
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
2799911 |
ctcctcctcaaggtctcaggttcgattctctctggtgccaatttgagggggtta |
2799964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 36371519 - 36371572
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36371519 |
ctcctcctcaaggtctgaggttcgattctctctgatgccaatttgagggggtta |
36371572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 14 - 81
Target Start/End: Original strand, 1247160 - 1247227
Alignment:
| Q |
14 |
tactcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggttatgttagtttctt |
81 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||| | ||||||||| |||||||| |||| ||||| |
|
|
| T |
1247160 |
tactcctcctcaaggtctcaggttcgattctctctggtaccaatttgaaggggttattttagcttctt |
1247227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 154 - 196
Target Start/End: Original strand, 43046347 - 43046389
Alignment:
| Q |
154 |
ttgccctcacgcaggatcgaactacggacctccagtttacaag |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43046347 |
ttgccctcacgcaggatcgaactacggaccttcagtttacaag |
43046389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 8177209 - 8177156
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| |||||||| |||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
8177209 |
ctcctcctcaaggtttcaggttcgattctctctggtgccaatttgagggggtta |
8177156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 8904463 - 8904516
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| |||||||||||| |||||||| |||||| ||||||||||||||||||| |
|
|
| T |
8904463 |
ctcctcctcaaggtctcaagttcgattctctctggtgccaatttgagggggtta |
8904516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 81
Target Start/End: Complemental strand, 9165222 - 9165157
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggttatgttagtttctt |
81 |
Q |
| |
|
||||| ||||| ||||||||||| ||| |||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
9165222 |
ctcctcctcaaagtctcaggttcaattctctctggtgccaatttgagggggttactttagtttctt |
9165157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 33700800 - 33700747
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||| ||||||||| ||||||||| |
|
|
| T |
33700800 |
ctcctcctcaaggtctcaggttcgattctctctggtgccaatttaagggggtta |
33700747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 23 - 69
Target Start/End: Original strand, 40810523 - 40810569
Alignment:
| Q |
23 |
tcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||| |||||| |
|
|
| T |
40810523 |
tcaaggtctcaggttcgattctctctggtgccaatttgagagggtta |
40810569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 22 - 69
Target Start/End: Original strand, 29753704 - 29753751
Alignment:
| Q |
22 |
ctcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||| || |||||| |
|
|
| T |
29753704 |
ctcaaggtctcaggttcgattctctctggtgccaatttaagagggtta |
29753751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 62
Target Start/End: Original strand, 3265973 - 3266019
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgag |
62 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||| | |||||||||| |
|
|
| T |
3265973 |
ctcctcctcaaggtctcaggttcgattctctctggttccaatttgag |
3266019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 69
Target Start/End: Original strand, 32524387 - 32524433
Alignment:
| Q |
23 |
tcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| ||||| |||||||| |||||| ||||||||||||||||||| |
|
|
| T |
32524387 |
tcaagatctcaagttcgattctctctggtgccaatttgagggggtta |
32524433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 65
Target Start/End: Original strand, 4566597 - 4566646
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggg |
65 |
Q |
| |
|
||||| |||| |||||||||||||||| ||||||||| |||||| ||||| |
|
|
| T |
4566597 |
ctcctcctcagggtctcaggttcgattctctctgatgtcaatttaagggg |
4566646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 65
Target Start/End: Complemental strand, 15786347 - 15786298
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggg |
65 |
Q |
| |
|
||||| ||||||||||||||||||||| ||| || || |||||||||||| |
|
|
| T |
15786347 |
ctcctcctcaaggtctcaggttcgattctctttggtgtcaatttgagggg |
15786298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 17 - 69
Target Start/End: Original strand, 11063606 - 11063658
Alignment:
| Q |
17 |
tcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
|||| |||||||||| |||||||||| ||||| ||||||||||| ||||||| |
|
|
| T |
11063606 |
tcctcctcaaggtcttaggttcgattctctctagtgccaatttgaaggggtta |
11063658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 59
Target Start/End: Original strand, 29056442 - 29056470
Alignment:
| Q |
31 |
tcaggttcgattatctctgatgccaattt |
59 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29056442 |
tcaggttcgattatctctgatgccaattt |
29056470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 60
Target Start/End: Original strand, 51814543 - 51814587
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttg |
60 |
Q |
| |
|
||||| ||||||||||||||||||||| |||| | |||||||||| |
|
|
| T |
51814543 |
ctcctcctcaaggtctcaggttcgattctctccggtgccaatttg |
51814587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0063 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0063
Description:
Target: scaffold0063; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 16 - 68
Target Start/End: Complemental strand, 35416 - 35364
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtt |
68 |
Q |
| |
|
||||| |||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
35416 |
ctcctcctcaaggtcttaagttcgattatctctgatgccaatttgagggggtt |
35364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 23 - 69
Target Start/End: Complemental strand, 11306194 - 11306148
Alignment:
| Q |
23 |
tcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
11306194 |
tcaaggtctcaggttcgattctctctggtgccaatttgagggggtta |
11306148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 23910138 - 23910087
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
23910138 |
ctcctcctcaaggtctcaggttcga--atctctggtgccaatttgagggggtta |
23910087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 12188330 - 12188277
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| |||||||| ||| |||||||| ||||| ||||||||||||||||||| |
|
|
| T |
12188330 |
ctcctcctcaaggtttcaagttcgattctctctagtgccaatttgagggggtta |
12188277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 13330136 - 13330189
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| ||||||||||||| ||||||| ||||| |||||||||||| |||||| |
|
|
| T |
13330136 |
ctcctcctcaaggtctcagattcgattctctcttgtgccaatttgagagggtta |
13330189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 60
Target Start/End: Original strand, 28363986 - 28364030
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttg |
60 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||| || ||||||| |
|
|
| T |
28363986 |
ctcctcctcaaggtctcagattcgattatctctggtgtcaatttg |
28364030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 8)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 65
Target Start/End: Original strand, 33017263 - 33017312
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggg |
65 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
33017263 |
ctcctcctcaaggtctcaggttcgattctctctggtgccaatttgagggg |
33017312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 196
Target Start/End: Complemental strand, 33306217 - 33306176
Alignment:
| Q |
155 |
tgccctcacgcaggatcgaactacggacctccagtttacaag |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33306217 |
tgccctcacgcaggatcgaactacggaccttcagtttacaag |
33306176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 22 - 69
Target Start/End: Original strand, 18540353 - 18540400
Alignment:
| Q |
22 |
ctcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||| |||||| |
|
|
| T |
18540353 |
ctcaaggtctcaggttcgattctctctggtgccaatttgagagggtta |
18540400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 1895619 - 1895577
Alignment:
| Q |
154 |
ttgccctcacgcaggatcgaactacggacctccagtttacaag |
196 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
1895619 |
ttgccctcacgcaggatcgaactgcggaccttcagtttacaag |
1895577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 155 - 196
Target Start/End: Original strand, 41139236 - 41139277
Alignment:
| Q |
155 |
tgccctcacgcaggatcgaactacggacctccagtttacaag |
196 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
41139236 |
tgccctcacgcaggatcgaactatggaccttcagtttacaag |
41139277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 65
Target Start/End: Original strand, 12988477 - 12988526
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggg |
65 |
Q |
| |
|
||||| |||||||| ||||||||||| |||||| ||||||||||||||| |
|
|
| T |
12988477 |
ctcctcctcaaggtttcaggttcgatcctctctggtgccaatttgagggg |
12988526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 31408149 - 31408096
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| |||||||| |||||||||||| ||||| ||| |||||| ||||||||| |
|
|
| T |
31408149 |
ctcctcctcaaggtttcaggttcgattctctctaatgtcaatttaagggggtta |
31408096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 60
Target Start/End: Original strand, 13129717 - 13129761
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttg |
60 |
Q |
| |
|
||||| |||||||| |||||||||||| |||||| |||||||||| |
|
|
| T |
13129717 |
ctcctcctcaaggtttcaggttcgattctctctggtgccaatttg |
13129761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0238 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0238
Description:
Target: scaffold0238; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 61
Target Start/End: Complemental strand, 2738 - 2693
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttga |
61 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
2738 |
ctcctcctcaaggtctcaggttcgattctctctggtgccaatttga |
2693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0126 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0126
Description:
Target: scaffold0126; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 61
Target Start/End: Complemental strand, 25374 - 25329
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttga |
61 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
25374 |
ctccttctcaaggtctcaggttcgattatctctggtgtcaatttga |
25329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 81591 - 81538
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggggtta |
69 |
Q |
| |
|
||||| ||||||||||||| ||||||| || |||||||||||||||||| |||| |
|
|
| T |
81591 |
ctcctcctcaaggtctcagattcgattctccctgatgccaatttgagggagtta |
81538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 64
Target Start/End: Complemental strand, 94998 - 94950
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgaggg |
64 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||| ||||||||| |||| |
|
|
| T |
94998 |
ctcctcctcaaggtctcaggttcaattatctctggtgccaatttaaggg |
94950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0211 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0211
Description:
Target: scaffold0211; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 31 - 62
Target Start/End: Original strand, 24117 - 24148
Alignment:
| Q |
31 |
tcaggttcgattatctctgatgccaatttgag |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24117 |
tcaggttcgattatctctgatgccaatttgag |
24148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0199 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0199
Description:
Target: scaffold0199; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 26 - 59
Target Start/End: Complemental strand, 8553 - 8520
Alignment:
| Q |
26 |
aggtctcaggttcgattatctctgatgccaattt |
59 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
8553 |
aggtctcaggttcgattatctctggtgccaattt |
8520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 65
Target Start/End: Complemental strand, 19989 - 19940
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttgagggg |
65 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||| || ||||||||||| |
|
|
| T |
19989 |
ctcctcctcaaggtctcaggttcgattctctctggtgttaatttgagggg |
19940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0194 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 60
Target Start/End: Complemental strand, 13073 - 13029
Alignment:
| Q |
16 |
ctcctactcaaggtctcaggttcgattatctctgatgccaatttg |
60 |
Q |
| |
|
||||| ||||||||||||||||||||| |||| |||| ||||||| |
|
|
| T |
13073 |
ctcctcctcaaggtctcaggttcgattctctccgatgtcaatttg |
13029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University