View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_high_136 (Length: 254)
Name: NF2519_high_136
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_high_136 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 30106831 - 30106590
Alignment:
| Q |
1 |
tcatcaagaatggataaaacgaagtgtttcagttcaactttcaacaaagacggcgtcgttccgttatggttgtggaaatgaaaactctccggcgaccggc |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30106831 |
tcatcaagaatggatagaacgaagtgtttcagttcaactttcaacaaagacggcgtcgttccgttatggttgtagaaatgaaaactctccggcgaccggc |
30106732 |
T |
 |
| Q |
101 |
gttgattcgcctgagaccttttgatcgccgccatgagagaattcgaaaccggcggctcttctaccggagatggttttgacgacgggaggcggtcgaggga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30106731 |
gttgattcgcctgagaccttttgatcgccgccatgagagaattcgaaaccggcggctcttctaccggagatggttttgacgacgggaggcggtcgaggga |
30106632 |
T |
 |
| Q |
201 |
tacgccgacggagagctcgagtgctcggaggtgaagacggtg |
242 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30106631 |
tacgccgacggagagctcaagtgctcggaggtgaagacggtg |
30106590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 100 - 152
Target Start/End: Complemental strand, 31781590 - 31781538
Alignment:
| Q |
100 |
cgttgattcgcctgagaccttttgatcgccgccatgagagaattcgaaaccgg |
152 |
Q |
| |
|
||||||||||||||||| | ||| ||||||||||| || |||||||||||||| |
|
|
| T |
31781590 |
cgttgattcgcctgagatcgtttaatcgccgccataagcgaattcgaaaccgg |
31781538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University