View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_high_152 (Length: 246)
Name: NF2519_high_152
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_high_152 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 14 - 214
Target Start/End: Complemental strand, 52600389 - 52600189
Alignment:
| Q |
14 |
atttacaatgctatggtatatgtataatgtcaaatatacttcaactacctgactgttgattagttgggataatcctcttcatcacctcttctggtaaatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52600389 |
atttacaatgctatggtatatgtataatgtcaaatatacttcaactacctgactgttgattagttgggataatcctcttcatcacctcttctggtaaatt |
52600290 |
T |
 |
| Q |
114 |
gccaagcacaaataacagaaatatggttatttttataagccgcgcaaccatgggcaaaattaaactaaattatatatgttgctatgtaagcattaaatag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52600289 |
gccaagcacaaataacagaaatatggttatttttataagccgcgcaaccatgggcaaaattaaactaaattatatatgttgctatttaagcattaaatag |
52600190 |
T |
 |
| Q |
214 |
t |
214 |
Q |
| |
|
| |
|
|
| T |
52600189 |
t |
52600189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University