View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_high_158 (Length: 242)
Name: NF2519_high_158
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_high_158 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 2 - 157
Target Start/End: Complemental strand, 33107551 - 33107396
Alignment:
| Q |
2 |
gcatagggaaatgaggaatatatcactaaactttatgagctatgctaggcttaaaacacattttttgaaagatatggagaagcataccctttttgttcta |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33107551 |
gcatagggaaatgaggaatatatcactaaactttatgagctatgctaggcttaaaacacattttttgaaagatatggagaagcataccctttttgttcta |
33107452 |
T |
|
| Q |
102 |
agctcttggaaagaaaattgtacattttcagctcaagatgaagcaaaaaaggtaag |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33107451 |
agctcttggaaagaaaattgtacattttcagctcaagatgaagcaaaaaaggtaag |
33107396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 156
Target Start/End: Original strand, 7618302 - 7618440
Alignment:
| Q |
18 |
aatatatcactaaactttatgagctatgctaggcttaaaacacattttttgaaagatatggagaagcataccctttttgttctaagctcttggaaagaaa |
117 |
Q |
| |
|
||||||||||| || ||| || | |||||||||||| ||||||| | |||||||| | ||||| ||||||| | ||||| |||| |||||||| |||| |
|
|
| T |
7618302 |
aatatatcactcaattttttgtgtcatgctaggcttagaacacatctattgaaagaggttgagaaacatacccgtcttgttttaagttcttggaaggaaa |
7618401 |
T |
|
| Q |
118 |
attgtacattttcagctcaagatgaagcaaaaaaggtaa |
156 |
Q |
| |
|
| |||||| |||||||||||||||| |||||||||| |
|
|
| T |
7618402 |
aaaccacatttgcagctcaagatgaagctaaaaaggtaa |
7618440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University