View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_high_171 (Length: 236)
Name: NF2519_high_171
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_high_171 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 4 - 230
Target Start/End: Complemental strand, 7802090 - 7801864
Alignment:
| Q |
4 |
gcctgttttcagaagacagcggttttttataagatctcttggaggtagcattgattatcataccaattgtagttctggaaaaatgcagtctgttgaggtt |
103 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7802090 |
gcctgttttcagaagacagcggtttttgataagatctcttggaggtagcattgattatcataccaattgtagttctggaaaaatgcagtctgttgaggtt |
7801991 |
T |
|
| Q |
104 |
gatgctcagagggttattagagaaattactcctgtcctagatcgaagtagacataaaggccaggcaggtacacaattcttgcaaatccatatcttcaann |
203 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7801990 |
gatgctgagagggttattagagaaattactcctgtcctagatcgaagcagacataaaggacaggcaggtacacaattcttgcaaatccatatcttcaatt |
7801891 |
T |
|
| Q |
204 |
nnnnncattaagtggtgatgatgatgt |
230 |
Q |
| |
|
|| ||||||||||||||||||| |
|
|
| T |
7801890 |
tttttcaataagtggtgatgatgatgt |
7801864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University