View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_high_181 (Length: 225)
Name: NF2519_high_181
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_high_181 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 16 - 187
Target Start/End: Complemental strand, 2845405 - 2845229
Alignment:
| Q |
16 |
atagggagttagagagtcctgtttagtctcgtaatcctcaat-------ttagaaacaaatgtgatcataatttgattaagactcttcaaaatcttttcc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2845405 |
atagggagttagagagtcctgtttagtctcgtaatcctcaatcctcaatttagaaacaaatgtgatcataatttgattaagact--tcaaaatcttttcc |
2845308 |
T |
 |
| Q |
109 |
atatcttttggctagtagttagctgatatagtgtaaaagtttttctgatnnnnnnnnntgctatggaattggatttcag |
187 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2845307 |
atatcttttggctagtagttagctgacatagtgtaaaagtttttctgataaaaaaaaatgctatggaattggatttcag |
2845229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University