View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_high_182 (Length: 219)
Name: NF2519_high_182
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_high_182 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 18 - 207
Target Start/End: Original strand, 42021032 - 42021221
Alignment:
| Q |
18 |
ggaccaagaaactcattggacaaggtttcatcataaacatcacttctgattctgattatgtcaatgttttctcaaaattcaatggaaatcctcctctgtt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
42021032 |
ggaccaagaaactcattggacaaggtttcatcataaacatcacttctgattctgattatgtcaatgttttctcaaaattcaatggaaatcctcgtctatt |
42021131 |
T |
|
| Q |
118 |
attgaaacagaacaaaggtactgatacgtttcaatatcaaaattttgaagtcaaagttttatgggatctttctgatgctaagtatgatga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42021132 |
attgaaacagaacaaaggtactgatacgtttcaatatcaaaattttgaagtcaaagttttatgggatctttctgatgctaagtatgatga |
42021221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University