View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2519_high_185 (Length: 215)

Name: NF2519_high_185
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2519_high_185
NF2519_high_185
[»] chr2 (1 HSPs)
chr2 (1-191)||(37288569-37288752)


Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 37288569 - 37288752
Alignment:
1 cttttgtcttcaatttggaatatctcaccttgattggttnnnnnnnnnnnnnggcttcatcataatttatttataagctcatatttaatacatgaaataa 100  Q
    |||||||||||| ||||||||||||||||||||||||||             ||||||||||||||||||||||||||||||||||||||||||||||||    
37288569 cttttgtcttcactttggaatatctcaccttgattggtttatatat------ggcttcatcataatttatttataagctcatatttaatacatgaaataa 37288662  T
101 agtctttgatcatgctcacggcttannnnnnnatatccaagtatgtcggtatctaagttttcaagtctaaaatttcttattctatgatatg 191  Q
    |||||||||||||||||| ||||||       ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
37288663 agtctttgatcatgctcatggcttatttttttatatccaagtatgtc-gtatctaagttttcaagtctaaaatttcttattctatgatatg 37288752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University