View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_high_189 (Length: 211)
Name: NF2519_high_189
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_high_189 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 13 - 194
Target Start/End: Complemental strand, 29110420 - 29110239
Alignment:
| Q |
13 |
aagaaaataccacataactaggcaattgaggtgttttcctgcaagttacccaaaaagttcttcaccaaatgatcatgatgatttctatgagaccgccaca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29110420 |
aagaaaataccacataactaggcaattgaggtgttttcctgcaagttacccaaaaagttcttcaccaaatgatcatgatgatttctatgagaccgccaca |
29110321 |
T |
 |
| Q |
113 |
agttgcatcgccatgaatgtatgagtgagttatttgtgttaactttaaagaactcaggaggaaactttatccaatgagtatt |
194 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29110320 |
agttgcatcgccatgaatgtatgaatgagttatttgtgttaactttaaagaactcaggaggaaactttatccaatgagtatt |
29110239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University