View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_high_52 (Length: 400)
Name: NF2519_high_52
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_high_52 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 11 - 319
Target Start/End: Original strand, 2528530 - 2528838
Alignment:
| Q |
11 |
cagagaacaaatcagacaggaaaatgaaacaaaacaaacatgtcagacaaaaaattcattcaatcaagctggtaaaatatttatgaaattaaaaatcatc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2528530 |
cagagaacaaatcagacaggaaaatgaaacaaaacaaacatgtcagacaaaaaattgattcaatcaagctggtaaaatatttatgaaattaaaaatcatc |
2528629 |
T |
 |
| Q |
111 |
atgtttctcatagagaaattaacaaaattcttccatttctctgcatatacatacaaaagcaaaattcagaaaactgatcccttgcatgcaggctcaaaga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2528630 |
atgtttctcatagagaaattaacaaaattcttccatttctctgcatatacatacaaaagcaaaattcagaaaactgatcccttgcatgcaggctcagaga |
2528729 |
T |
 |
| Q |
211 |
cactcacaaatctcaactgaattccaattgtgaaatcctaaaccctacattcaaaaaccacaaaagaccctttgaaatttctacaccaaaacccctttga |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2528730 |
cactcacaaatctcaactgaattccaattgtgaaatcctaaaccctacattcaaaaaccacaaaagaccctttgaaatttctacaccaaaacccctttga |
2528829 |
T |
 |
| Q |
311 |
tttgaacaa |
319 |
Q |
| |
|
||||||||| |
|
|
| T |
2528830 |
tttgaacaa |
2528838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University