View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_high_56 (Length: 393)
Name: NF2519_high_56
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_high_56 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 20 - 381
Target Start/End: Complemental strand, 26126682 - 26126311
Alignment:
| Q |
20 |
cattactcattaatcattgtcttcaaattactcgtcttgtcaccttccggatgcatcttctccctcagttaaaatccttgctgccgtcacacaactatcc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26126682 |
cattactcattaatcattgtcttcaaattactcgtctcgtcaccttccggatgcatcttctccctcagttaaaatccttgctgccgttacacaactatcc |
26126583 |
T |
|
| Q |
120 |
aaaactcagaatcgatgtgagatatctagaagtgggaaaaatttaacaaatatccaaaacttgttcagtgttggctcttttttgttgcca-nnnnnnngt |
218 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26126582 |
aaaactcaaaatcgatgtgagatatctagaagtgggaaaaatttaacaaatatccaaaacttgttcagtgttggctcttttttgttgccattttttttgt |
26126483 |
T |
|
| Q |
219 |
taccaatcagtgggggtgactaggtt---------tgcaaggaagccccttcctccaccttatttattgccagttttccatggggtaccgctaagttccc |
309 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
26126482 |
taccaatcagtgggggtaactaggtttgatgcatatgcaagggagccccttcctccaccttatttattgccagttttccacggggtgccgctaagttccc |
26126383 |
T |
|
| Q |
310 |
tcatccagtcatctcagtaaaaagattttatatttttaggttagaagaaagatttggagtaggaaatatatt |
381 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26126382 |
tcatccagtcatcccagtaaaaagattttatatttttaggttagaagaaagatttggagtaggaaatatatt |
26126311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University