View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_high_65 (Length: 374)
Name: NF2519_high_65
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_high_65 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 136 - 351
Target Start/End: Complemental strand, 54673864 - 54673649
Alignment:
| Q |
136 |
gttttgtcgagtttaagttcgaaccgaggatagataggatcgccatgactaactcaacggtcaacatttataactaatttgtcattatttataaaataat |
235 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54673864 |
gttttgccgagtttaagtttgaaccgaggatagataggatcgccatgactaactcaacggtcaacatttataactaatttgtcattatttataaaataat |
54673765 |
T |
|
| Q |
236 |
taaattgaggccattttttggtccaaaattttgaggactaaaaaaccctagcttgaactacttgacccttagactagcccattgtacgacaactcaaaca |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54673764 |
taaattgaggccattttttggtccaaaattttgaggactaaaaaaccctagcttgaactacttgacccttagactagcccattgtacgacaactcaaaca |
54673665 |
T |
|
| Q |
336 |
agtgtttaaatatata |
351 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
54673664 |
agtgtttaaatatata |
54673649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 82
Target Start/End: Complemental strand, 54673981 - 54673918
Alignment:
| Q |
19 |
acatgtcggtgtaagacacttgtacaaccagagtcaatccaataaagtttataacgaggctttt |
82 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||| ||||||| ||||||||||||||||| |
|
|
| T |
54673981 |
acatgtcggtgtaagaaacttgtacaaccaaagtcaattcaataaaatttataacgaggctttt |
54673918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University