View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_high_69 (Length: 358)
Name: NF2519_high_69
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_high_69 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 32 - 320
Target Start/End: Complemental strand, 36586397 - 36586107
Alignment:
| Q |
32 |
caaaacatgcagatatatatttagactcgcctttgtatgaatgaaagtaatcaat--agtctggaaagtcttgaacagggactatcagtggttannnnnn |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36586397 |
caaaacatgcagatatatatttagactcgactttgtatgaatgaaagtaatcaatcgagtctggaaagtcttgaacagggactatcagtggttatttttt |
36586298 |
T |
|
| Q |
130 |
naggctaatttatagcacgctatgttagtatccactatccatggttcgaaggttggaccttctgattattactcctttcatggccctcagctcaccgatc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36586297 |
taggctaatttatagcacgctatgttagtatccactatccatggtttgaaggttggactttctgattattactcctttcatggccctcagctcaccgatc |
36586198 |
T |
|
| Q |
230 |
gagctgtctgcttaactatttaatttcgtagaaactaatctttgcattgattatggccttctaatgaatttttgttgattttgtttatatt |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36586197 |
gagctgtctgcttaactatttaatttcgtagaaactaatctttgcattgattatggccttctaatgaatttttgttgattttgtttatatt |
36586107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University