View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_high_87 (Length: 322)
Name: NF2519_high_87
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_high_87 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 18 - 300
Target Start/End: Original strand, 45328444 - 45328727
Alignment:
| Q |
18 |
aaaaataaagagcatcaacaacagggtgagtttcaatgccagagaaattttttgtgttgaaagagtatattatgacaccgacagagaggtatataaggag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45328444 |
aaaaataaagagcatcaacaacagggtgagtttcaatgccagagaaattttttgtgttgaaagagtatattatgacaccgacagagaggtatataaggag |
45328543 |
T |
 |
| Q |
118 |
aagccaaatgccttgtcgaatgatggaattggtttgaggtttgggaagttgaggttggtcattgatgggtttaaggtgtgggagaatgaacatagctggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45328544 |
aagccaaatgccttgtcgaatgatggaattggtttgaggtttgggaagttgaggttggtcattgatgggtttaaggtgtgggagaatgaacatagctggt |
45328643 |
T |
 |
| Q |
218 |
gctgttttgcagcggctgag-nnnnnnngtttgtgatgagaaaataattgttgttgtggagtgaagttgatggattgtatctca |
300 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45328644 |
gctgttttgcagcggctgagttttttttgtttgtgatgagaaaatgattgttgttgtggagtgaagttgatggattgtatctca |
45328727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University