View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_high_98 (Length: 304)
Name: NF2519_high_98
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_high_98 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 53 - 287
Target Start/End: Complemental strand, 29062239 - 29062000
Alignment:
| Q |
53 |
ttacgatgattcaccttcattttaccggcaagaccaaagaaacacccaattcaacttgatcatgttcatagtttgtttttggtggtagagcaactgttga |
152 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||| ||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29062239 |
ttacgatgattcaccatgattttaccggcaagaccaaagaaacaccgaattcaacttgatgatgtccatagtttgtttttggtggtagagcaactgttga |
29062140 |
T |
|
| Q |
153 |
ttaatttctctcatgcttatgcaaagtctcttgtcttgaaactcaaa-----gaaaagaaaaggacatatgtggtagagaagacaatcttttaaattagt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |||||||||| |||| |
|
|
| T |
29062139 |
ttaatttctctcatgcttatgcaaagtctcttgtcttgaaactcaaagaaaggaaaagaaaaggacatagctggtagagaagagaatcttttaagttagc |
29062040 |
T |
|
| Q |
248 |
caagtgtcataagtgagaagtcattcacattgtcaaatgt |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29062039 |
gaagtgtcataagtgagaagtcattcacattgtcaaatgt |
29062000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University