View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_high_99 (Length: 302)
Name: NF2519_high_99
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_high_99 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 60 - 283
Target Start/End: Original strand, 36524234 - 36524457
Alignment:
| Q |
60 |
ttcgcgaggtgaaaatgagcatagtgcaagagcttgaatttgagaagaagataaggaggcaaactgagagactgaacatgaagatttccaaagaaatgga |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36524234 |
ttcgcgaggtgaaaatgagcatagtgcaagagcttgaatttgagaagaagataaggaggcaaactgagagactgaacatgaagatttccaaagaaatgga |
36524333 |
T |
 |
| Q |
160 |
gaacataaaagattcctattcaaaactctctaaggaacacgaaatggagaaaagggctaaagagattttggagcaagtttgtgatgaattagccaaaggc |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36524334 |
gaacataaaagattcctattcaaaactctctaaggaacacgaaatggagaaaagggctaaagagattttggagcaagtttgtgatgaattagccaaaggc |
36524433 |
T |
 |
| Q |
260 |
gttggagaagatagagcacaagta |
283 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36524434 |
gttggagaagatagagcacaagta |
36524457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University