View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_low_105 (Length: 300)
Name: NF2519_low_105
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_low_105 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 283
Target Start/End: Complemental strand, 2693761 - 2693475
Alignment:
| Q |
1 |
tatgaaatagtttttgaaaagggaaatgctatttaaagcaacagatttgttattatatggttaattaaactacaacacaatcaaataccgtaaacctcgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2693761 |
tatgaaatagtttttgaaaagggaaatgctatttaaagcagcagatttgttattatatggttaattaaactacaacacaatcaaataccgtaaacctctc |
2693662 |
T |
|
| Q |
101 |
aaaataataatcaaataccgtnnnnnnngacaatcaaatgctctctgtggaaaaa----ataggaaataattacaatctatgcaagatgcatctgctata |
196 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2693661 |
aaaataataatcaaataccgtaaaaaaagacaatcaaatgctctctgtggaaaaaaaatataggaaataattacaatctatgcaagatgcatctgatata |
2693562 |
T |
|
| Q |
197 |
catttctannnnnnnngcttttctttcttctctaccttatgcaagcaattatcctactattgacctagcaaaacctatccctattca |
283 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2693561 |
catttctattttttttgcttttctttcttctctaccttatgcaagcaattatcctactattgacctagcaaaacctatccctattca |
2693475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 216 - 267
Target Start/End: Complemental strand, 2686910 - 2686858
Alignment:
| Q |
216 |
tttctttcttctctaccttatgcaa-gcaattatcctactattgacctagcaa |
267 |
Q |
| |
|
|||||||| |||||| ||||||||| |||||||| |||| ||||||||||||| |
|
|
| T |
2686910 |
tttctttcctctctagcttatgcaaagcaattattctaccattgacctagcaa |
2686858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University