View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_low_121 (Length: 273)
Name: NF2519_low_121
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_low_121 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 22 - 230
Target Start/End: Complemental strand, 33612844 - 33612636
Alignment:
| Q |
22 |
cagaccaattacaaaaatataatgctagtggatgcatccgatagacaaaattaactactgcattaccacaaaacgcaaaattacaacggcaagaaaaata |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33612844 |
cagaccaattacaaaaatataatgctagtggatgcatccgatagacaaaattaactcctgcattaccacaaaacgcaaaattacaacggcaagaaaaata |
33612745 |
T |
 |
| Q |
122 |
gtagaatacaaatcccatctaatagatttctataaaacttatgctgcattgcaattaggggtgggaataggtcatccagagctaggctttaaaacaccta |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||| ||||||||||| || |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33612744 |
gtagaatacaaatcccatctaatagatttatataaaacttgtgctgcaatgcaattagggatgagaataggtcatccagagctaggctttgaaacaccta |
33612645 |
T |
 |
| Q |
222 |
agtctgcct |
230 |
Q |
| |
|
||||||||| |
|
|
| T |
33612644 |
agtctgcct |
33612636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University