View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_low_122 (Length: 269)
Name: NF2519_low_122
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_low_122 |
 |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 45410168 - 45409915
Alignment:
| Q |
1 |
aaatcccttgatgcatatataattgaaactcataccaaacatgattggatacctaagaatgctgatgcaaccggcaagaaatgccattccacagcaactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45410168 |
aaatcccttgatgcatatataattgaaactcataccaaacatgattggatacctaagaatgctgatgcaaccggcaagaaatgccattgcacagcaactt |
45410069 |
T |
 |
| Q |
101 |
gtttcacagatggaaaaccctagaaaaggggtaagctagggggaaaacgtacaagcatccactgtctctcatatgtagctaaatgagtccatccaacttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45410068 |
gtttcacagatggaaaaccctagaaaaggggtaagctagggggaaaacgtacaagcatccactgtctctcatatgtagctaaatgagtccatccaacttc |
45409969 |
T |
 |
| Q |
201 |
ttcaagcaaagagagctttagtttatatagtttcttcttcgcaggctcagtatc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45409968 |
ttcaagcaaagagagctttagtttatatagtttcttcttcgcaggctcagtatc |
45409915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 120 - 249
Target Start/End: Complemental strand, 48701 - 48572
Alignment:
| Q |
120 |
ctagaaaaggggtaagctagggggaaaacgtacaagcatccactgtctctcatatgtagctaaatgagtccatccaacttcttcaagcaaagagagcttt |
219 |
Q |
| |
|
|||||||||||| ||| | || || ||||| ||||||||||||||||| || ||||||||||||| ||||||||| || ||||| || ||||||||| |
|
|
| T |
48701 |
ctagaaaaggggcaaggttggagggaaacgcacaagcatccactgtctttcgtatgtagctaaatatttccatccaatctcatcaagtaatgagagcttt |
48602 |
T |
 |
| Q |
220 |
agtttatatagtttcttcttcgcaggctca |
249 |
Q |
| |
|
|| | ||||||||||||||| ||||||||| |
|
|
| T |
48601 |
agctcatatagtttcttcttggcaggctca |
48572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University