View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_low_127 (Length: 264)
Name: NF2519_low_127
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_low_127 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 39 - 253
Target Start/End: Original strand, 934317 - 934530
Alignment:
| Q |
39 |
gaatttgttgaattgtcaacatttttgttcatatattattttgtctttttaattaagaaccatacgaataatatctaaggatatgcacataaattttgtc |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
934317 |
gaatttgttgaattgtcaacatttttgttcatatattattttgtctttttaattaagaaccataagaataatatctaaggatatgcacataagttttgtc |
934416 |
T |
|
| Q |
139 |
cnnnnnnnnatccttcttaaagataagaatttccaaccatatagtaccttctagggtttggagagtttgatttgggtgtatagtgtcttctctcatccgt |
238 |
Q |
| |
|
| |||||||||| ||||||||||||||| |||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
934417 |
c-tttttttatccttcttagcgataagaatttccaatcatatagtgtcttctagggtttggagagtttaatttgagtgtatagtgtcttctctcatccgt |
934515 |
T |
|
| Q |
239 |
cttcatcgtgtttca |
253 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
934516 |
cttcatcgtgtttca |
934530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University