View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_low_141 (Length: 252)
Name: NF2519_low_141
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_low_141 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 35417435 - 35417197
Alignment:
| Q |
1 |
cccacaagacataacaaccattgtctcaaattctaattccaacattgtttctcataactcattagatatgttgaaaaatttgaaggtgtttgtttatgag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35417435 |
cccacaagacataacaaccattgtctcaaattctaattccaacgttgtttctcataactcattagatatgttgaaaaatttgaaggtgtttgtttatgag |
35417336 |
T |
|
| Q |
101 |
ctaccttcaaaatacaacaatgattggcttgtaaatgggaggtgtaaaacacatttgtttgcttcagaagttgctattcacaccgcattgttgaaaagtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35417335 |
ctaccttcaaaatacaacaatgattggcttgtaaatgggaggtgtaaaacacatttgtttgcttcagaagttgctattcacaccgcattgttgaaaagtg |
35417236 |
T |
|
| Q |
201 |
atgtgagaacttttgacccttatgaagctgatttcttct |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35417235 |
atgtgagaacttttgacccttatgaagctgatttcttct |
35417197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 196 - 239
Target Start/End: Complemental strand, 12172910 - 12172867
Alignment:
| Q |
196 |
aagtgatgtgagaacttttgacccttatgaagctgatttcttct |
239 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||| |||| |
|
|
| T |
12172910 |
aagtgatgttagaacttttgacccttacgaagctgattttttct |
12172867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 146 - 239
Target Start/End: Original strand, 21056021 - 21056114
Alignment:
| Q |
146 |
aaaacacatttgtttgcttcagaagttgctattcacaccgcattgttgaaaagtgatgtgagaacttttgacccttatgaagctgatttcttct |
239 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||| | || || || | ||||||||| |||||||||||||| |||||||||||||| |||| |
|
|
| T |
21056021 |
aaaactcatttatttgcttcagaagttgctattcatagagctttattaacaagtgatgtaagaacttttgacccatatgaagctgattttttct |
21056114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University