View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_low_144 (Length: 250)
Name: NF2519_low_144
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_low_144 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 18 - 250
Target Start/End: Original strand, 47385898 - 47386130
Alignment:
| Q |
18 |
aattttgcatagtgagatgcacaaagggccaaaatcaaacaatatcaaaataacatattggtgttttctaggtatcatcnnnnnnnggtagtgttttcta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
47385898 |
aattttgcatagtgagatgcacaaagggccaaaatcaaacaatatcaaaataacatattggtgttttctaggtatcatctttttttggtggtgttttcta |
47385997 |
T |
 |
| Q |
118 |
ggtatcatctagttgcaccttaatacagtatataataaaaagaggatatttaaatattactccctccgttccataataaattagctatttgtnnnnnnnt |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| ||||| | ||||||||||||| ||||||| | |
|
|
| T |
47385998 |
ggtatcatctagttgcaccttaataccgtatataataaaaagaggatacttaaatattactgcctccttcccataataaattaattatttgtaaaaaaat |
47386097 |
T |
 |
| Q |
218 |
atcgttctaaaaaattgattcatttcacttttc |
250 |
Q |
| |
|
||||| | ||||||||||||||||||||||||| |
|
|
| T |
47386098 |
atcgtcccaaaaaattgattcatttcacttttc |
47386130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University