View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2519_low_150 (Length: 250)

Name: NF2519_low_150
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2519_low_150
NF2519_low_150
[»] chr8 (1 HSPs)
chr8 (14-250)||(43451860-43452096)


Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 14 - 250
Target Start/End: Original strand, 43451860 - 43452096
Alignment:
14 aggccactgttgatgggatgattggcgagttacgctgtgcaatcaataacctgtacatgtcagagattctccaggaatctgaaatggcggctcttcaaat 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43451860 aggccactgttgatgggatgattggcgagttacgctgtgcaatcaataacctgtacatgtcagagattctccaggaatctgaaatggcggctcttcaaat 43451959  T
114 agagaagttgtggagaggagggaatctgggagtggatatccacagcatgctatcaaaacctccaattattaatgggtttgtggagatacttttcaattct 213  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43451960 agagaaattgtggagaggagggaatctgggagtggatatccacagcatgctatcaaaacctccaattattaatgggtttgtggagatacttttcaattct 43452059  T
214 gttgaaccccaggttcttcaggcagcagttttccttc 250  Q
    |||||||||||||||||||||||||||||||||||||    
43452060 gttgaaccccaggttcttcaggcagcagttttccttc 43452096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University