View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_low_154 (Length: 247)
Name: NF2519_low_154
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_low_154 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 8 - 247
Target Start/End: Original strand, 29061833 - 29062072
Alignment:
| Q |
8 |
agatgaagagagaaaatgcctnnnnnnngtgtgtggagataaagtcaaagaagagagggaaggctctgatagtacatagatgtctcataagtgaaaggat |
107 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
29061833 |
agatgaagagagaaaatgcctaaaaaaagtgtgtggagataaagtcaaagaagagagggaaggctctgacattacatagatgtctcataagtgaaaggat |
29061932 |
T |
|
| Q |
108 |
cttattgaccagtaacaaattcagacactttaatttgtctttgtgtaggaaaaagttatcatgaattacacatatgcagacaatcttctttgctacgatt |
207 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29061933 |
cttattgaccagtaacaaattcagacattttaatttgtctttgtgtaggaaaaagttatcatgaattacacatatgcagacaatcttctttgctacgatt |
29062032 |
T |
|
| Q |
208 |
tccagtaattttgtgatattagaaactttgaatttttaac |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29062033 |
tccagtaattttgtgatattagaaactttgaatttttaac |
29062072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University