View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_low_159 (Length: 243)
Name: NF2519_low_159
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_low_159 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 1764687 - 1764925
Alignment:
| Q |
1 |
tatgatattttcattagggacaatctattt-gtaaaacgatcgatcgatctattacatnnnnnnnntgtagagatgatctatannnnnnnnnnngaaagg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| | ||||||||||||||||| |||||| |
|
|
| T |
1764687 |
tatgatattttcattagggacaatctattttgtaaagcgatcgatcgatctattacgtaaaaaaaatgtagagatgatctatattttttttt--gaaagg |
1764784 |
T |
 |
| Q |
100 |
aagagagatgatctatataaatattggatataatttttattttaagtagtata----ttggctagaaatttatctttaagtaactaagtgggaaatgaaa |
195 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1764785 |
aagagagatgatttatataaatatttgatataatttttattttaagtagtatatatattggctagaaatttatctttaagtaactaagtgtgaaatgaaa |
1764884 |
T |
 |
| Q |
196 |
tcagagttcaactcccattcactgcttatacagtataatct |
236 |
Q |
| |
|
|| |||||||| |||||||||| |||||||| | |||||| |
|
|
| T |
1764885 |
gcacagttcaacccccattcactccttatacaatgtaatct |
1764925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University