View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_low_160 (Length: 242)
Name: NF2519_low_160
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_low_160 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 31078656 - 31078432
Alignment:
| Q |
1 |
ttaacatgaccttattaatttttattgatctttgtggcttcgcttctcaattcttaccaagaagccacccttcatcaatgaggtaaggtgtgcaatgtac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31078656 |
ttaacatgaccttattaatttttattgatctttgtggcttcgcttctcaattcttaccgagaagccacctttcatcaatgaggtaaggtgtgcaatgtac |
31078557 |
T |
 |
| Q |
101 |
tccggctcaacccctttatccatcgcaggaaccaccctaaactgcctcatgatccctgcaaccaccctcttcatctgcaagaacgccatttcctttccta |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31078556 |
tccggctcaacccctttatccattgcaggaaccaccctaaactgcctcatgatccctgcaaccaccctcttcatctgcaagaacgccatttcctttccta |
31078457 |
T |
 |
| Q |
201 |
aacacaccctcggcccagcttgaaa |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
31078456 |
aacacaccctcggcccagcttgaaa |
31078432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 41 - 225
Target Start/End: Complemental strand, 31127934 - 31127750
Alignment:
| Q |
41 |
cgcttctcaattcttaccaagaagccacccttcatcaatgaggtaaggtgtgcaatgtactccggctcaacccctttatccatcgcaggaaccaccctaa |
140 |
Q |
| |
|
||||||||||| |||||| ||||||||| ||||| | || |||||||||||| | ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31127934 |
cgcttctcaatctttaccaggaagccacctttcattatcgaagtaaggtgtgcagcgaactccggctcaacccctttatccattgcaggaaccaccctaa |
31127835 |
T |
 |
| Q |
141 |
actgcctcatgatccctgcaaccaccctcttcatctgcaagaacgccatttcctttcctaaacacaccctcggcccagcttgaaa |
225 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
31127834 |
actgcctcatgatcccggcaaccacccttttcatctgcaagaacgccatttcctttcctaaacacacccttggcccagcctgaaa |
31127750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 107 - 225
Target Start/End: Complemental strand, 31132579 - 31132458
Alignment:
| Q |
107 |
tcaacccctttatccatcgcaggaaccaccctaaactgcctcatgatccctgcaaccaccct---cttcatctgcaagaacgccatttcctttcctaaac |
203 |
Q |
| |
|
|||||||||| ||||||||| |||| || |||||||| ||| || || || |||||| ||| |||||| | |||||||||||||| || ||||||| |
|
|
| T |
31132579 |
tcaaccccttcatccatcgctggaagcaacctaaactcccttataatgccaacaaccaacctgatcttcatttctaagaacgccatttctttccctaaac |
31132480 |
T |
 |
| Q |
204 |
acaccctcggcccagcttgaaa |
225 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
31132479 |
acaccctcggcccagcttgaaa |
31132458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University