View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_low_165 (Length: 239)
Name: NF2519_low_165
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_low_165 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 16 - 209
Target Start/End: Complemental strand, 6681413 - 6681220
Alignment:
| Q |
16 |
atatagatgcggcctccttcggtttctggattgatatttttgacaagcaaaggctgggtcaagactggatataaaaa-cattctatccttgatgctctca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6681413 |
atatagatgcggcctccttcggtttctggattgatatttt-gacaagcaaaggctgggtcaagactggatataaaaaacattctatccttgatgctctca |
6681315 |
T |
 |
| Q |
115 |
acttttttcaacatcaatgttgaaaaattgtaaacaaaaactgcagtaaccttatcttgtgaatggaaaatttgtattagaaacagtacattgtt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6681314 |
acttttttcaacatcaatgttgaaaaattgtaaacaaaaactgcagtaaacttatcttgtgaatggaaaatttgtattagaaacagtacattgtt |
6681220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 142 - 225
Target Start/End: Complemental strand, 6675955 - 6675871
Alignment:
| Q |
142 |
ttgtaaacaaaaactgcagtaa-ccttatcttgtgaatggaaaatttgtattagaaacagtacattgttggatccttacaagtga |
225 |
Q |
| |
|
||||||||| |||||||||||| || ||||| | ||| |||||||| |||| |||| |||||||||||||||||| ||||||| |
|
|
| T |
6675955 |
ttgtaaacataaactgcagtaaacccaatcttataaatagaaaatttctattcgaaatagtacattgttggatcctatcaagtga |
6675871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 90
Target Start/End: Original strand, 6664112 - 6664185
Alignment:
| Q |
16 |
atatagatgcggcctccttcggtttctggattgatatttttgacaagcaaaggctgggtcaagactggatataaa |
90 |
Q |
| |
|
||||||| ||||||||||| |||||||||||| | | ||||||||||||||||| ||||| ||| |||||||| |
|
|
| T |
6664112 |
atatagactcggcctccttcagtttctggattggt-tgcttgacaagcaaaggctgagtcaacactagatataaa |
6664185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University