View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_low_168 (Length: 239)
Name: NF2519_low_168
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_low_168 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 9255813 - 9255601
Alignment:
| Q |
19 |
cggtgaaatttaattctccatgaagatggagagtaccgacgactagatggtaagacccggaatgaaagtagattcgtgagaggggtgcaactgcttgagt |
118 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||| ||||||| |||||||||||| |||||||||| |||||||||||||||| ||||||| |
|
|
| T |
9255813 |
cggtgaaatttaattctccgtgaagatggagagtaccgatgacaagatggtcagacccggaatggaagtagattcatgagaggggtgcaacttcttgagt |
9255714 |
T |
|
| Q |
119 |
ggaaaggatttttgcacccgtttgcgtacttataaactcattatcagactatttcttatccaatatatcatatatgtatcttctaacaactcgtcttata |
218 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| ||||||||||||||||| |
|
|
| T |
9255713 |
ggaaaagatttttgcacccgtttgcgtacttataaactcattatcagactatttcttatccaat-------atatgtctctt-taacaactcgtcttata |
9255622 |
T |
|
| Q |
219 |
tttctttccatatgtctcgtt |
239 |
Q |
| |
|
|||||||||||||| |||||| |
|
|
| T |
9255621 |
tttctttccatatggctcgtt |
9255601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University