View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_low_182 (Length: 230)
Name: NF2519_low_182
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_low_182 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 29062208 - 29062431
Alignment:
| Q |
1 |
attaacgttcaaaatttaaatacaccattgtgttgctttgtgagagataatggtgattcggatgttgagaattttactccccatctttcctctgatatcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29062208 |
attaacgttcaaaatttaaatacaccattgtgtcgctttgtgagagataatggtgattcggatgttgagaattttactccccatctttcctctgatatcg |
29062307 |
T |
 |
| Q |
101 |
ttgacaatattggaactatgatcccattatcaaacgctttaggagaggataatattgctcgggagtgcatcccaatggataattttatgtttatatgacg |
200 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29062308 |
ttgacaagattggaactatgatcccactatcaaacgctttaggagaggataatattgctcgggagtgcatcccaatggataattttatgtttttatgacg |
29062407 |
T |
 |
| Q |
201 |
tgcacatcgttggaacttccaata |
224 |
Q |
| |
|
|||| ||||||||||||||||||| |
|
|
| T |
29062408 |
tgcatatcgttggaacttccaata |
29062431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University