View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2519_low_182 (Length: 230)

Name: NF2519_low_182
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2519_low_182
NF2519_low_182
[»] chr2 (1 HSPs)
chr2 (1-224)||(29062208-29062431)


Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 29062208 - 29062431
Alignment:
1 attaacgttcaaaatttaaatacaccattgtgttgctttgtgagagataatggtgattcggatgttgagaattttactccccatctttcctctgatatcg 100  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29062208 attaacgttcaaaatttaaatacaccattgtgtcgctttgtgagagataatggtgattcggatgttgagaattttactccccatctttcctctgatatcg 29062307  T
101 ttgacaatattggaactatgatcccattatcaaacgctttaggagaggataatattgctcgggagtgcatcccaatggataattttatgtttatatgacg 200  Q
    ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
29062308 ttgacaagattggaactatgatcccactatcaaacgctttaggagaggataatattgctcgggagtgcatcccaatggataattttatgtttttatgacg 29062407  T
201 tgcacatcgttggaacttccaata 224  Q
    |||| |||||||||||||||||||    
29062408 tgcatatcgttggaacttccaata 29062431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University