View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_low_183 (Length: 230)
Name: NF2519_low_183
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_low_183 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 32334121 - 32333893
Alignment:
| Q |
1 |
cggagttcgagaagtgacgttcttggttctggaactgggaactatggtcatggtagtataatgcgtggtggtggtgttggagttgttaccgggaaggagg |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32334121 |
cggagttcgagaagtgatgttcttggttctggaactgggaactatggtcatggtagtataatgcgtggtggtggtgttggagttgttaccgggaaggtgg |
32334022 |
T |
 |
| Q |
101 |
agagtaacagtatgagaagtggcattgcgggtgatttaggaaaaannnnnnntgcagagtgtggatccagaagagttgaagaaagctgggaatgagcatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32334021 |
agagtaacagtatgagaagtggcattggaggtgatttaggaaaaa-ggggggtgcagagtgtggatccagaagagttgaagaaagctgggaatgagcatt |
32333923 |
T |
 |
| Q |
201 |
acaaaaagggtcatttttcagatgcattga |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32333922 |
acaaaaagggtcatttttcagatgcattga |
32333893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University