View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_low_42 (Length: 432)
Name: NF2519_low_42
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_low_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 309; Significance: 1e-174; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 23 - 359
Target Start/End: Original strand, 45717313 - 45717649
Alignment:
| Q |
23 |
tataagaattggattcgataatagtagttggatatgtttgtaacgtatagaagccacgtggtcccnnnnnnnngtgattgtaaatggaaacgttagttgg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45717313 |
tataagaattggattcgataatagtagttggatatgtttgtaacgtatagaagccacgtggtcccaaaaaaaagtgattgtaaatggaaacgttagttgg |
45717412 |
T |
|
| Q |
123 |
attgtccattcactccacgtcctataaatggaaccactcctccctcgtctttatcaaccaacaactgtgtcttgtgttgtaaactaaattgttcttttgt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45717413 |
attgtccattcactccacgtcctataaatggaaccactcctccctcgtctttatcaaccaacaactgtgtcttgtgttgtaaactaaattgttcttttgt |
45717512 |
T |
|
| Q |
223 |
aacactttctttctttcaaatttcaactcaaaatattgaaaatgggcacagctacatgcatcgatattattcttgccatcatccttccacctcttggtgt |
322 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45717513 |
aatactttctttctttcaaatttcaactcaaaatattgaaaatgggcacagctacatgcatcgatattattcttgccatcatccttccacctcttggtgt |
45717612 |
T |
|
| Q |
323 |
cttcctcaagtttggctgcaacgtaatatataaaacc |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45717613 |
cttcctcaagtttggctgcaacgtaatatataaaacc |
45717649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 251 - 341
Target Start/End: Original strand, 45746004 - 45746094
Alignment:
| Q |
251 |
caaaatattgaaaatgggcacagctacatgcatcgatattattcttgccatcatccttccacctcttggtgtcttcctcaagtttggctgc |
341 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||| ||| ||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
45746004 |
caaaagatcgaaaatgggcacagctacatgcatcgatatcattgttgccatcatcctccctcctctcggtgtcttcctcaagtttggctgc |
45746094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 261 - 337
Target Start/End: Original strand, 45705178 - 45705254
Alignment:
| Q |
261 |
aaaatgggcacagctacatgcatcgatattattcttgccatcatccttccacctcttggtgtcttcctcaagtttgg |
337 |
Q |
| |
|
||||||||||||||||| | | | ||||| |||||| ||||| |||| || |||||||||||||||||||| ||||| |
|
|
| T |
45705178 |
aaaatgggcacagctaccttcgttgatatcattctttccatcctcctacctcctcttggtgtcttcctcaaatttgg |
45705254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University