View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_low_45 (Length: 425)
Name: NF2519_low_45
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_low_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 375; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 375; E-Value: 0
Query Start/End: Original strand, 1 - 417
Target Start/End: Complemental strand, 26422456 - 26422043
Alignment:
| Q |
1 |
tcatcaaaattcccgcaaaacctgaagtaaagctcctcactcagaaaaaatttgtgcccatcatcaaaattccagcaactgactcctcccacttgacacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26422456 |
tcatcaaaattcccgcaaaacctgaagtaaagctcctcactcagaagaaatttgtgcccatcatcaaaattcccgcaactgactcctcccacttgacacc |
26422357 |
T |
|
| Q |
101 |
actattctcatatcgcccttttcaattttattcctccccaatattcacttttgtactccagattttagttccacttgcagtttcctttgagttctttttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26422356 |
actattctcatatcgcccttttcaattttattcctccccaatattcacttttgtactccagattttagttccacttgcagtttcctttgagttctttttt |
26422257 |
T |
|
| Q |
201 |
atccctaaaatattaatctttccctgaatgtgcatcaccacatgcctgaacttcagctattttctccggctggagtcttaaagtttggaagcatcttctc |
300 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26422256 |
atccctaaaatattaatctgtccctgaatgtgcatcaccacatgcctgaacttcagctattttctccggctggagtcttaaagtttggaagcatcttctc |
26422157 |
T |
|
| Q |
301 |
atatagtctcttctatgaattgtctttcttaatgaataactaacttaggtgttttctccccctgttccacgatatttccagtaatcaattcttttaatgt |
400 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26422156 |
atatagtctcttctatgaattgtctttctcaatgaataactaactta---gttttctccccctgttccacaatatttccagtaatcaattcttttaatgt |
26422060 |
T |
|
| Q |
401 |
cattccacacctatgct |
417 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
26422059 |
tattccacacctgtgct |
26422043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University