View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_low_50 (Length: 410)
Name: NF2519_low_50
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_low_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 179 - 402
Target Start/End: Complemental strand, 38516371 - 38516149
Alignment:
| Q |
179 |
gattatgattattttggaagagatgaaagaaacgcgtttgttaaataggagaattggaaatgatgaaaataagggttttgatggcgggaataagcaagct |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
38516371 |
gattatgattattttggaagagatgaaagaaacgcgtttgttaaataggagaattggaaatgatgaaaagaagggttt-gatggcgggaataagcaagct |
38516273 |
T |
|
| Q |
279 |
gtttggcgggataagttgccgcttggaactgctgtgaaaattttgtagcttttttggtttcggcttgggtttttattaaattgattacgggttatatgag |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38516272 |
gtttggcgggataagttgccgcttggaactgctgtgaaaattttgtagcttttttggtttgggcttgggtttttattaaattgattacgggttatatgag |
38516173 |
T |
|
| Q |
379 |
ggttagctacacactacctttgct |
402 |
Q |
| |
|
|||||||||||||||| |||||| |
|
|
| T |
38516172 |
tgttagctacacactacttttgct |
38516149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 111; E-Value: 7e-56
Query Start/End: Original strand, 19 - 129
Target Start/End: Complemental strand, 38516526 - 38516416
Alignment:
| Q |
19 |
ggatctacacgatcggagccgtctggggagacgtagatgcgtggacggggtaggcttgaaccgtagaatttggatggttttagagaaacaaccattttgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38516526 |
ggatctacacgatcggagccgtctggggagacgtagatgcgtggacggggtaggcttgaaccgtagaatttggatggttttagagaaacaaccattttgg |
38516427 |
T |
|
| Q |
119 |
aagcgattttg |
129 |
Q |
| |
|
||||||||||| |
|
|
| T |
38516426 |
aagcgattttg |
38516416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University