View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_low_52 (Length: 404)
Name: NF2519_low_52
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_low_52 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 2e-93; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 1 - 178
Target Start/End: Complemental strand, 13231002 - 13230825
Alignment:
| Q |
1 |
ttttggatttatgtttatccttatctgtatgtgtaacaatcaaacggacttaacaattttataaggggacattaaaataactggtcactttggactgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13231002 |
ttttggatttatgtttatccttatctgtatgtgtaacaatcaaacggacttaacaattttataaggggacattaaaataactggtcactttggactgatt |
13230903 |
T |
|
| Q |
101 |
gatatgtattttattaattaacaatgcaacaaggcttatcataaaagtaacaaatgttatccccttctaaaaattaaa |
178 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13230902 |
gatatgtatttaattaattaacaatgcaacaaggcttatcataaaagtaacaaatgttatccccttctaaaaattaaa |
13230825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 250 - 397
Target Start/End: Complemental strand, 13230759 - 13230612
Alignment:
| Q |
250 |
cactaggtcagataccaactatgattgtttattaaaaacaaacattaaatataaaaaggaagctgtaactcctttatcctcacaaacaagacgtgcaagt |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13230759 |
cactaggtcagataccaactatgattgtttattaaaaacaaacattaaatataaaaaggaagctgtaactcctttatcctcacaaacaagacgtgcaagt |
13230660 |
T |
|
| Q |
350 |
tttgtcttctaaaacatcaaaaatgacaaacacagtaacagtataatc |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13230659 |
tttgtcttctaaaacatcaaaaatgacaaacacagtaacagtaaaatc |
13230612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University