View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_low_71 (Length: 360)
Name: NF2519_low_71
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_low_71 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 16328029 - 16327799
Alignment:
| Q |
1 |
taaatgtaagtttggacactcacgaaatctagcactagtaggactatttacttggcgaagaattgcaacaagtgtaaggttatctccattctcaagtgaa |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16328029 |
taaatgtaagtttggaccctcacgaaatctagcactagtaggactatttacttggcgaagaattgcaacaagtgtaaggttatctccattctcaagtgaa |
16327930 |
T |
 |
| Q |
101 |
aaaccattgagggcccatctaagagctctagcactgaaatttatagatgcatggtggatcaccactaccctttgtgattcatgagacatgatcaactcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16327929 |
aaaccattgagggcccatctaagagctctagcactgaaatttatagatgcatggtggatcaccactaccctttgtgattcatgagacatgatcaactcta |
16327830 |
T |
 |
| Q |
201 |
cttggtttaatgttcaaataggatttgttac |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16327829 |
cttggtttaatgttcaaataggatttgttac |
16327799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 302 - 360
Target Start/End: Complemental strand, 16327704 - 16327646
Alignment:
| Q |
302 |
gggtatatctcgttggggactaatcttttatgataccagaatctatttaaagaagtgtt |
360 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16327704 |
gggtatatctagttggggactaatcttttatgataccaaaatctatttaaagaagtgtt |
16327646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University