View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2519_low_81 (Length: 336)
Name: NF2519_low_81
Description: NF2519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2519_low_81 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 1 - 328
Target Start/End: Complemental strand, 33612602 - 33612275
Alignment:
| Q |
1 |
gcctgtcataagcttaagcttgttttttaagcgcattagcaacaattttgatatgcagctcttaaacatcttcagcaaccggccactagaacttgtgcaa |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33612602 |
gcctatcataagcttaagcttgttttttaagcgcattagcaacaattttgatatgcagctcttaaacatcttcagcaaccggccactagaacttgtgcaa |
33612503 |
T |
 |
| Q |
101 |
aacaatacgtagggaaaattatttatttaatagatttatataaaacatttatatcaattaggatctttataaacaatccaattcaagttgatttaaattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33612502 |
aacaatacgtagggaaaattatttatttaatagatttatataaaacatttatatcaattaggatctttataaacaatccaattcaagttgatttaaattg |
33612403 |
T |
 |
| Q |
201 |
caataagggatctgaaaagcaaaaaatggaacgatccacagtttgttcactcatgttcaatctatggaaaccatttttatgtgtgattgtttcatatggt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33612402 |
caataagggatctgaaaagcaaaaaatggaacgatccacagtttgttcactcatgttcaatccatggaaaccatttttatgtgtgattgtttcatatggt |
33612303 |
T |
 |
| Q |
301 |
tgctgcttctttttaggttgttcatctc |
328 |
Q |
| |
|
|||||||| ||||||||||||||||||| |
|
|
| T |
33612302 |
tgctgcttgtttttaggttgttcatctc |
33612275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University