View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2520_high_15 (Length: 249)
Name: NF2520_high_15
Description: NF2520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2520_high_15 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 12 - 249
Target Start/End: Complemental strand, 3845794 - 3845557
Alignment:
| Q |
12 |
aattctcctgagacgtgtagtgaggaagatataacttgaaattaaatcccttgttgtagcacaattgaataattgcattgttttgtgccaccaatttatc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3845794 |
aattctcctgagacgtgtagtgaggaagatataacttgaaattaaatcccttgttgtagcacaattgaataattgcattgttttgtgccaccaatttatc |
3845695 |
T |
 |
| Q |
112 |
agtaggtggtcccttaggtggtggtggaataaatcggagtaatgctattatgtagaaaatgttgctgtctggcaccactaccgagtgtctatcatcccac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3845694 |
agtaggtggtcccttaggtggtggtggaataaatcggagtaatgctattatgtagaaaatgttgctgtctggcaccactaccgagtgtctatcatcccac |
3845595 |
T |
 |
| Q |
212 |
ctgattaatcataaaaacaagaaccttaattattaatc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3845594 |
ctgattaatcataaaaacaagaaccttaattattaatc |
3845557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University