View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2520_high_19 (Length: 237)
Name: NF2520_high_19
Description: NF2520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2520_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 21 - 222
Target Start/End: Original strand, 54947640 - 54947840
Alignment:
| Q |
21 |
agatccaagccgtgggacaatttttcagttgaaatccaattgcggcactgtatcttctaaatatagtaatcaaactatttagaatttcccnnnnnnnnnn |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| | |
|
|
| T |
54947640 |
agatccaagccgtgggacaatttttcagttgaaatccaattacggcactgtattttctaaatatagtaatcaaactatttagaatttctc-aaaaaaatt |
54947738 |
T |
|
| Q |
121 |
nnnnnnnncaatttaaaagttgttgatagttttgtgnnnnnnncttccccggcaatgttatgtgaccgaccgtttgccaagcattttttatagagataaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
54947739 |
aaaaaaagcaatttaaaagttgttgatagttttgtgaaaaaaacttccccggcaatgttgtgtgaccgaccgtttgccaagcatttttcatagagataaa |
54947838 |
T |
|
| Q |
221 |
cc |
222 |
Q |
| |
|
|| |
|
|
| T |
54947839 |
cc |
54947840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University