View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2520_low_15 (Length: 254)
Name: NF2520_low_15
Description: NF2520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2520_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 37 - 246
Target Start/End: Complemental strand, 7790428 - 7790219
Alignment:
| Q |
37 |
tgaatataatataattgactagtacaaatgtagaataaaaataaatttagttgttaacgnnnnnnngttaaaaattagttgaagatgagctaggttcaag |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7790428 |
tgaatataatataattgactagtacaaatgtagaataaaaataaatttagttgttaaccaaaaaaagttaaaaattagttgaagatgagctaggttcaag |
7790329 |
T |
 |
| Q |
137 |
gttcaacttttgtaaacgcttctttgacaaattaattatgatatcttaaagcnnnnnnnngaaataatatctcaattacaattcatatccaattaaaatt |
236 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7790328 |
gttcaacttttgtaaacgcttttttgacaaattaattatgatatcctaaagcaaaaaaaagaaataatatctcaattacaattcatatccacttaaaatg |
7790229 |
T |
 |
| Q |
237 |
atctttatta |
246 |
Q |
| |
|
||||||||| |
|
|
| T |
7790228 |
ctctttatta |
7790219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University