View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2520_low_21 (Length: 228)
Name: NF2520_low_21
Description: NF2520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2520_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 16 - 214
Target Start/End: Complemental strand, 36086264 - 36086066
Alignment:
| Q |
16 |
aaaagaaggaaggtatggatctgagcacaacacttggttatactcgtggatgctttcaaacctctcgaagaagagaaagttgcttcagccaatctcaagt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36086264 |
aaaagaaggaaggtatggatctgagcacaacacttggttatactcgtggatgctttcaaacctctcgaagaagagaaagttgcttcagccaatctcaagt |
36086165 |
T |
 |
| Q |
116 |
cgctatggaagaaagtttaggaaaatttgaagactaaggtagctggagatgctgctcctggcgatgtttagattcttcttacttctaaggaacattctg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36086164 |
cgctatggaagaaagtttaggaaaatttgaagactaaggtagctggagatgctgctcctggcgatgtttagattcttcttacttctaaggaacattctg |
36086066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 162 - 206
Target Start/End: Original strand, 48392994 - 48393038
Alignment:
| Q |
162 |
agatgctgctcctggcgatgtttagattcttcttacttctaagga |
206 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
48392994 |
agatgctgctcctggtgatgttcagattcttcttacttctaagga |
48393038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University