View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2520_low_22 (Length: 218)
Name: NF2520_low_22
Description: NF2520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2520_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 17 - 200
Target Start/End: Original strand, 47846420 - 47846600
Alignment:
| Q |
17 |
aatatggttgtaaaatatgttgatcagaaattaaattagatgaagaattctgatcactccttcttccattgctctcatgattagcactagctaataattt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47846420 |
aatatggttgtaaaatatgttgatcagaaattaaattagatgaagaattct---cactccttcttccattgctctcatgattagcactagctaataattt |
47846516 |
T |
|
| Q |
117 |
attacgtgcttgtaattgttgttctttacgatgcttccctaaaagcttctttttcagttttgtgttccaatagttctttatatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47846517 |
attacgtgcttgtaattgttgttctttacgatgcttcccaaaaagcttctttttcagttttgtgttccaatagttctttatatc |
47846600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 116 - 197
Target Start/End: Complemental strand, 4686218 - 4686137
Alignment:
| Q |
116 |
tattacgtgcttgtaattgttgttctttacgatgcttccctaaaagcttctttttcagttttgtgttccaatagttctttat |
197 |
Q |
| |
|
|||||||||||||| |||||| |||||||| || ||||| |||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
4686218 |
tattacgtgcttgttgttgttgatctttacggtgtttccccaaaagcttctttttcaaccttgtattccaatagttctttat |
4686137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 200
Target Start/End: Original strand, 40253987 - 40254031
Alignment:
| Q |
156 |
taaaagcttctttttcagttttgtgttccaatagttctttatatc |
200 |
Q |
| |
|
|||||| ||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
40253987 |
taaaagtttcttcttcaactttgtgttccaatagttctttatatc |
40254031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University