View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2521_high_28 (Length: 222)

Name: NF2521_high_28
Description: NF2521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2521_high_28
NF2521_high_28
[»] chr2 (1 HSPs)
chr2 (1-205)||(16068264-16068468)


Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 16068264 - 16068468
Alignment:
1 ctagttatggggacgagcaatcttggaggcgtgtcaatccatttgtgagagggatctccccctaaacaaccgaaacaacatccatatacaccggtgcaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
16068264 ctagttatggggacgagcaatcttggaggcgtgtcaatccatttgtgagagggatatccccctaaacaaccgaaacaacatccatatacaccggtgcaaa 16068363  T
101 agaggataaaaagattaccatttaacaacgattgtagtgatagttatgttaaaaaagttgatacgtgatatttttgtagttaagttgatgtgtcgtgaaa 200  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
16068364 agaggataaaaagactaccatttaacaacgattgtagtgatagttatgttaaaaaagttgatgcgtgatatttttgtagttaagttgatgtgtcgtgaaa 16068463  T
201 cactt 205  Q
    |||||    
16068464 cactt 16068468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University