View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2521_low_31 (Length: 222)
Name: NF2521_low_31
Description: NF2521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2521_low_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 16068264 - 16068468
Alignment:
| Q |
1 |
ctagttatggggacgagcaatcttggaggcgtgtcaatccatttgtgagagggatctccccctaaacaaccgaaacaacatccatatacaccggtgcaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16068264 |
ctagttatggggacgagcaatcttggaggcgtgtcaatccatttgtgagagggatatccccctaaacaaccgaaacaacatccatatacaccggtgcaaa |
16068363 |
T |
|
| Q |
101 |
agaggataaaaagattaccatttaacaacgattgtagtgatagttatgttaaaaaagttgatacgtgatatttttgtagttaagttgatgtgtcgtgaaa |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16068364 |
agaggataaaaagactaccatttaacaacgattgtagtgatagttatgttaaaaaagttgatgcgtgatatttttgtagttaagttgatgtgtcgtgaaa |
16068463 |
T |
|
| Q |
201 |
cactt |
205 |
Q |
| |
|
||||| |
|
|
| T |
16068464 |
cactt |
16068468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University