View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2522_high_2 (Length: 368)
Name: NF2522_high_2
Description: NF2522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2522_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 24 - 351
Target Start/End: Complemental strand, 7181339 - 7181012
Alignment:
| Q |
24 |
tgcttttcccaaaattccattatccagtgccaaagaaaactcttttaacactaaacctgaagagaaatccaattctaagaatcaaagcttcaaaagatga |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7181339 |
tgcttttcccaaaattccattatccagtgccaaagaaaactcttttaacactaaacctgaagagaaatccaattctaagaatcaaagcttcaaaagatga |
7181240 |
T |
|
| Q |
124 |
taatgggcaatcaccaaattggtctaagtggattcccaccggctcttttgctgctgacaaagttttcagattgatttcaagtgctactgctagtcccatt |
223 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7181239 |
taatggtcaatcaccaaattggtctaagtggattcccaccggctcttttgctgctgacaaagttttcagattgatttcaagtgctactgctagtcccatt |
7181140 |
T |
|
| Q |
224 |
ggacagtttgtttcttcccccaccacttttcttcactctattgatccacgagttaaattggtaagcaaatttgtttcatgggttttgtattttactctga |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7181139 |
ggacagtttgtttcttcccccaccacttttcttcactctattgatccacgagttaaattggtaagcaaatttgtttcatgggttttgtagtttactctga |
7181040 |
T |
|
| Q |
324 |
atttgatgtaaaagaatgtgctttttat |
351 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
7181039 |
atttgatgtaaaagaatgtgctttttat |
7181012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University