View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2522_high_6 (Length: 286)
Name: NF2522_high_6
Description: NF2522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2522_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 17 - 280
Target Start/End: Original strand, 39377904 - 39378167
Alignment:
| Q |
17 |
atgaactaatttagctataacccgaacttgattctcaaaatccttgaacctttcaacaccattttcaccaattctacgaactgctaaagaagttccatct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39377904 |
atgaactaatttagctataacccgaacttgattctcaaaatccttgaacctttcaacaccattttcaccaattctacgaactgctaaagaagttccatct |
39378003 |
T |
|
| Q |
117 |
tcaagaacagctttatacattatacttgaaccagtagctcctaaaatatacgcagaagctttcaaaagtgtttccacttcaagctctctttcaccatcaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39378004 |
tcaagaacagctttatacattatacttgaaccagtagctcctaaaatatacgcagaagctttcaaaagtgtttccacttcaagctctctttcaccatcaa |
39378103 |
T |
|
| Q |
217 |
ctatgaccagagtgcccgtacccgaacccgtaccagctttattctcaccttgcctttgcttctc |
280 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
39378104 |
ctatgaccagagtgcctgtacccgaacccgtaccagctttattctcaccttgcttttgattctc |
39378167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University