View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2522_high_7 (Length: 277)
Name: NF2522_high_7
Description: NF2522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2522_high_7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 64 - 190
Target Start/End: Complemental strand, 3165112 - 3164987
Alignment:
| Q |
64 |
cttgcttttttggggatcttctgccaggatacaagacggctggcaatgacttcatcgattccttcctcagtcgctgcagtcacggatttatctgaccctt |
163 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
3165112 |
cttgcttttttggggatcttctgctaggatacaagatggctggcaatgacttcatcgat-ccttccttagtcgctgcagtcacggattcatctgaccctt |
3165014 |
T |
|
| Q |
164 |
tcattcatcatctcgcaccttccctac |
190 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
3165013 |
tcattcatcatctcgcaccttccctac |
3164987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 44320763 - 44320816
Alignment:
| Q |
224 |
tgaatgctttggtgcccaactagttggaacagatttccaacgtctcattcgacc |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44320763 |
tgaatgctttggtgcccaactagttggaacagatttccaacgtctcattcgacc |
44320816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University