View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2522_high_7 (Length: 277)

Name: NF2522_high_7
Description: NF2522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2522_high_7
NF2522_high_7
[»] chr5 (1 HSPs)
chr5 (64-190)||(3164987-3165112)
[»] chr1 (1 HSPs)
chr1 (224-277)||(44320763-44320816)


Alignment Details
Target: chr5 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 64 - 190
Target Start/End: Complemental strand, 3165112 - 3164987
Alignment:
64 cttgcttttttggggatcttctgccaggatacaagacggctggcaatgacttcatcgattccttcctcagtcgctgcagtcacggatttatctgaccctt 163  Q
    |||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| ||||||| |||||||||||||||||||| |||||||||||    
3165112 cttgcttttttggggatcttctgctaggatacaagatggctggcaatgacttcatcgat-ccttccttagtcgctgcagtcacggattcatctgaccctt 3165014  T
164 tcattcatcatctcgcaccttccctac 190  Q
    |||||||||||||||||||||||||||    
3165013 tcattcatcatctcgcaccttccctac 3164987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 224 - 277
Target Start/End: Original strand, 44320763 - 44320816
Alignment:
224 tgaatgctttggtgcccaactagttggaacagatttccaacgtctcattcgacc 277  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44320763 tgaatgctttggtgcccaactagttggaacagatttccaacgtctcattcgacc 44320816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University