View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2523_low_4 (Length: 252)
Name: NF2523_low_4
Description: NF2523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2523_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 14 - 236
Target Start/End: Original strand, 49007163 - 49007385
Alignment:
| Q |
14 |
cataggtatcactaaaatatctcacttattgttaacttgatcaacaacgaatactggaggtttttatttataatacatatgaatccatatcaaaattaac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49007163 |
cataggtatcactaaaatatctcacttattgttaacttgatcaacaacgaatactggaggtttttatttataatacatatgaatccatatcaaaattaac |
49007262 |
T |
 |
| Q |
114 |
caaatttatatcgaataataggcatggctccacatgctcatgtatccatgtacaaggtgttgtggaaagaaggagcatatgcatctgatacaatagctgc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49007263 |
caaatttatatcgaataataggcatggctccacatgctcatgtatccatgtacaaggtgttgtggaaagaaggagcatatgcatctgatacaatagctgc |
49007362 |
T |
 |
| Q |
214 |
aattgatagtgcaatatcagatg |
236 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
49007363 |
aattgatagtgcaatatcagatg |
49007385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 57
Target Start/End: Original strand, 37067889 - 37067929
Alignment:
| Q |
17 |
aggtatcactaaaatatctcacttattgttaacttgatcaa |
57 |
Q |
| |
|
|||||| |||||||||||||| |||||| |||||||||||| |
|
|
| T |
37067889 |
aggtattactaaaatatctcatttattgataacttgatcaa |
37067929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University