View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2524_high_14 (Length: 337)
Name: NF2524_high_14
Description: NF2524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2524_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 98 - 329
Target Start/End: Complemental strand, 21661000 - 21660771
Alignment:
| Q |
98 |
ttttgtaaaggcctaaggaggatctgtcctatttggaaatggattctttggagttatgagttttgtgctagaagcaagttttgattgttggatgaagatc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||| ||||| |||||||||||||||| |
|
|
| T |
21661000 |
ttttgtaaaggcctaaggaggatctgtcctatttggaaatggattctttggagttatgagttttgt--ttggagcaaattttgtttgttggatgaagatc |
21660903 |
T |
 |
| Q |
198 |
agacgacatatgnnnnnnnagttattaaattggattt-aagtacaatttattgtgcaacttggatcctttgttattatgcagtagcaaaaataagggtgc |
296 |
Q |
| |
|
||||||||| || |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21660902 |
agacgacatgtgtttttt-agttattaaattggattttaagtacaatttattgtgcaacttggatcctttgttattatgcagtagcaaaaataagggtgc |
21660804 |
T |
 |
| Q |
297 |
aaattttcactctacttggagatcgtctgtgtt |
329 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
21660803 |
aaattttcactctacttggagatcgtctctgtt |
21660771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 74
Target Start/End: Complemental strand, 21661052 - 21660997
Alignment:
| Q |
19 |
cttttacgtgcctaattaatggaaagaataatgttgaccttttgaaattatgtttt |
74 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21661052 |
cttttatgtgcctaattaatgaaaagaataatgttgaccttttgaaattatgtttt |
21660997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University